JFIF,,AdobedExifMM*; JiT >webmaster5555 2015:01:16 12:22:242015:01:16 12:22:24webmasterICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋICC_PROFILE }xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|ICC_PROFILE } "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{ՑICC_PROFILE |{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmICC_PROFILE jmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"ICC_PROFILE pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:ICC_PROFILE N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ 2015-01-16T12:22:24.547webmaster C   %# , #&')*)-0-(0%()(CMYK }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzCMYK?z%wmǞ7dd\@W '1𲵴ʠ4D5ADE[s2@\7XN?Z[q4;`156jKȃ6rUvk[3n+7oƷ-n'k~n%ݷi3N$ =]hDciqLSaޒ?E~HHSjeB-Kt)Zsǽ%}{}Ux~su2ґjfMqozD|G_=+]!U]#Ɛ]^fol:}| 5F5}l1`c_W]oXIWtok&*J(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((} *p)W!k"xa|gfZ"Q(skqs*c,צi_ kf蝬:d\wr.2z\ܘOD#z5%dt V]\eZM| wp\O|4 UQ!nspEmUnu3C1sV0lm-SIqp#&~>ޜpbwIb`>yp. Fo'YH~\riwmc9Zַ E,A>a_WI LiA&YUxH85~ofEa+df+G]#?)p3KfQJ\i捲1^oYO^\@=j I ŋ>s <jp"?lXLɗڦ_(; A Q7C֫ e*kbWI@16q$/Z+!;/oj%'^U pab?`$As1?9!]b^*ֲ0~6_> !a?WQnso#(2ۏUlS (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((G4!kg>x DO5_dj3y^2MR=T޵k@;>1Yd隰"9@F6kilg#*x##{^TZnE9۞ 5E;NjͰ%22)fbda 貼d!Ug2 ¯(4!RjBChC$rHR韦i&/QI;5򫬖 pZLjfH1WobX'J8;]|)sDLSeHRօ |޼Kn~Oz/a԰`1TI'8+k^u!l-8AUgvGR MXwV[5 rkl@ǏPjdM\sk#FP'[U3ghY5QBvj+o)zOcOWm9%4W.[a|,|1/#cco75Z%AEQEQEQEQE(2~qۚ(=袊EsGEoGoJ(g<:(QEr)*(LR}xQsEtQsQQE-Qg(R}hQQE⒊a n$tQYWqxHy捦y#Q€$$61eUSycM.0I#?J}*Zuj(٥Qӭ! (1ErzsGRҜvCJLEEQQߊZ(^nZ>QG8OQȣZ(hϨ4QEQ4{E>LE3E":HuuNF})H*pEC׃EixSGQEI(?Z(;f(=}('Ҋ(uzEΊ((צE{RE)3(=htQG/(sOQۥ袓==iG9E#DgcQjۘ纸m†G#ɥD.ʪ2@B'lK&M8nki6gM LN8O+!u}f6ށF{}^F9( E}q@sE}h8sEshr:~tth sE34QKcڊ)0s~QG(((()7ҧ_(k hj ;l+/8*̚2yw0'akohWAvBX urZ9`JoJBX0.GUhɤu?*A'92l[̸I6<(NуpFHjqm"ӳ_ZSYt]0R@sƳw.PAW6_j4cjB) ,e#e(vޤX[L͖,Xvw2baG3jl2+>>?fR!O%v?W#tDߤ ck y6Q\gn$eU\@*x# u-RGm.Ӯ" @qަ #hq5w:0sU 2c)EQ˱h/c`Y7m V*82NTjyW [DaS*5QL~O:8"訠\z] RKxY'@KxCC-WWo?y~Fu[((( Vev2cT.x5 ;xO!Gٜ jE~@$g ƪoRhQڲD7n9yM׉E'Ûcuo=N'`ʄ.}9Zkl5 ZHm&\g5?ffu%kjOkw#NPlojhF P/Xѡx|ȉwO36XAH5"H)2cmCĚ-쵭Ind FE@)$m=>1諶Q9K˝:8]2m8ϱ_j0'ý;G.mGP6ܣď֫YZr1gZiTbZ/="L+޸kw=Ds$*r/* |8PD݁N. jWk%j6z ē|HUEZZG`l2LӭUGGv!̀gNK">P4 6٤*rex[J5_o ]]_T½r?}j8b:#%>GВ[);Pk[ t^%(dw^fy/q-Ӕ9Kk]ڹ[;tI ʟzl1M#|u9In~MA97fAP3[߉{4g&$?/LP6OTUQOϕԒ=snLlˍ?Ŗ # [ٜR/ҕZeϭ!~3ت,<{Ő_hpV6/mYsE0%ӵK٥Io+H&T񮯪j,5ŴIf qC&;cyyHU]Lr@k%Am)~cq:WC\uZlZ{jr6! OWmnYyh /]ANT$.ՌRoJ]!iZ07 qDf[ciM0~ͬlֳb[R?O[M/N|_;ƺz[aӥ_%"Sڴxl>@w^MVEy_5)O{pyWˡa\ο[kV53]]>K7(۩f[X[.B)`2d)ClAc_ieEinJM:xu β!b;%89j՟V?TL&lX [kz_79XORV<:LиD/$zdEH.D|K<άıfHcIw̭png$8oP;QjbfkxTW(tS[$'Y. @6e`A]O~Kk}WUKKyd] g/",A>%!NP"﹞Q2"azTK=>8gi}:薚γ-0Y1#`gޙ%Đ"hdtNfP9.hnZ WN!Vi<=V?/{ Hb#z0o?Y,>ŵ3$}Zd$;2XwOBԮdFYfVn $ H߀V[6$,ӋSie);Z'񕇊uiz53e"+}na$1$=js3)rִPѿOθO$ $'bk>ܧ,7ꎱ3 ~ecIp5_] d.LlsWxmEZx.wHDMFi%pZŚޣ6/ s[-o[FCD9 )m g ʒ}(ؤ1DK7)B2>Y's֬5_s' $|\F4ț^HH n怣JL, uNjݝ"Kٝ ˟b/X5/k7,q5pmpоw6EM .6;NzKIm/Qvˣ6O#\Zw[N[K%m=W/ 5]1$ʻC %NzS Ϥ+"?{SA/~&zZHj' Z[xWaZ ֟G$wV;L*}*KWKn(m֯2CX^>I we5{2d^+@@=)uF3ocoq Fnqjo6Y.'|LQAf4!bno*j[c9w$<^.fY;a85?}վuk cw<2q}X8F2"y٬!$;MIHr ^sx^/ZƙN;P@ Sm2BV`S}#:9 V5'd`eN u?'Ιyqgr."Q4Q'U<<ͩJp"يG"N'Ŵs$#t篥qkW:ݿ-VQ(.3PWmͩv'YPɾʑegV nj3jwi$qX:y7Ŀ_k1K;y[â>Ztڎ;^[lo1$BE jfŊysFSeFt9ǥg'uU}ֵt"04{nh3j-dQ{~ͻ{D}[{gsZ̶[kzWk. h{R;#>Hn+u 1VexP n}*~uh~$dQ\ƭ>c]GYծEݽ8>Va5;Kx%܍{O[KY<}(nAb_]m|qEĺ _jŌIgujPD1 {kOj.$1LU_s 0Y|Kִ[oh6 m vazwHt2 &bstP;T.FDA=괷w In MrEk?h:ĺy 0Q]#㯽Z >dV;%# *'Ao:%`hIX\M{̼r:QkG/k3k }LXo_CC‡PpD_x(V>D>𩮮e:u1V{|suGw=N%5dD 9n9,&h -ېOa|ҷnI&9j\4ZX\rHk;c×nu%֫]E*F}nG,()0P:zFx\R]>nw; BlV?ĽkXy[_ٴ SipCX㹍 .y\ r jj!"5O y{뻭SQoK߈u;vWy s,2dӎ&mM-"?"MqIe#%rpj/>Eqquo6uRƷ|@t9M->̘h|F*_"&Samk8<q$.+U"k2iQKEQEQEQEJ}~}= }1|S_E?Aėӏq?R̎rcKҀmKu F+*3̸Z$)|fm&g*v:c5p å8!ʹ{"' 3ȮQc pE>.` ʩ0#ҹi{y BlA*RⶭD]4x<PC})6W֥Sh-m8=ǭ\wG}Ji}yYAB{|g 7  ,\žzԃsJL59'}+K[åy';WN ]0RcdY4NZ<NA8dyrm+sNJKDH :Rk3#IyP*er>QSڻ8>֮UK[^`O5Ƥ4j7Qp#QH-$|AIg8}([#f_Ư$1Mb@ma ʼ?3Y5RQEQEQEQEFOn|gx%+WχCWk6{jCy@T}BQmED qPMoO1$h܌;mEHIm0,k:m5 _r 1T/dxՋGE1±# >RM~BBpH|CW헉d #[e6r0HmI0APidWYwAumlV%ˉ$Voy)H0NzT7z\یsOJs0TzfC!##Ef2]iMV5) &C0]SVP"h(mĆM9`ʼn{Tqis@yFۈ:~VѮ_Dw&HR$FK~$ڴSG!ESRжA9QS=~s+9a:l+m[Ğ%n^55ݣ ߥ@5[{X0CV ڞ-Ǜ+Ϙ0F)mPI0Q>F櫦xcK4} 4p/B4u(yɌǃH"$̻sѵ}'FI5sbO ˥rn/P04}jEP»V38>dQM%Z|k<,)ڠ񊵬2t]7q$R,6*K{zS`,%E%g#Sٌ"JP5`Y\op9/Q2vڭfn TI-_<Εu>ֳ)M8 Hl1#',OSK6nLmn<n^sӵ>M:ë{epxW/ Ipp>]qҕ%Lce9昺Cy"G+eU9VomTZp۪,NF$&{PئF\+BaaWz'4/ x~HmbǫRMg]\=M9F@Jka*:5Wǝ#b\>_pZ^n'Υu45˱nzƯͭ]>LH#K(o0obIiÉ"b#=P|V1/k PHaz3O+xs(Y"-4 0#ErcY[WFO]'| nWXHE Hv"HaΤ3.ՍV+m[YXcj<K_ ՌMr# 0^ ֛~S@f% 0ވ +;NEUWrlH:~gtg;w8*dHMr:_.+`i/V#D,b񶙯[a b# `J`ݗ-#L'IU۷ "G@k#?4kIwe  qۊYc1d`"cvU64qDn6TkTҥF'RO1t3{bwByca_ܫ FfmS[,f|-?>#U0@!USl0ߞs 炻v⫦gq)X޸Xlz767tXmrFGnQHL &QAKMMho(&Y^Iq,j৖8R"5b0۷u$՛H&t8 box{Yn'WMַ8czyqDnGRԐNK،bQemp4ψEf KrivpLg0)l`晨X!fh..j5ZKҷ!$Hiڀh& )k#*Sj.S8V\*ȓ3ڽ׌|Es k5p[aznN80ȖvnϏ[?Ҙm 2،R%"il0e ?Z*[M3^Th֏ Pc,0z~T_hRVB𷗑CF Hd${,!д M7SS'7),A 'ߧYpF ˷-O0Uv:w\42A?'ODJsncE2[B==;!˅:_F̑s IF@2>j)5; l^kHKu tz(t4rW'JFMcm˴3Bi,|Vқv:vk9m5lCs~| zD1ծR NҮ rH#Al6F>vt wWn:uNYuݭŰmps翥D4-k `x{+D=3So^i\i6,ep:#>rW\j0$aI_OKˉܠ*)t(H`~+Q4ZneBzbr3Ա%R/29fa%cS^euG9e:X \.j߉>G]v}YFmzHZ%YY,2S}9ZF*9|8Amgė7:UvBp4_h-V56{kr^ lidY{`) Rj 4}gZV[TTږzy?6-Rh,bIC˃5I3I/Ϟ&R9F.\ 6լfk-:;X:`& xXI -\:V *xߤ7\4p0¶!5Wľ ק)c#A95ڦ`x}⤒jD⼲4z0OڋV@H95Exi]EDFbEVn͍α8IsBq^=/2W2N#@W3,ݪiמ%q km,kQА 1Vdq kmaI.,&ހ FdsOe9!PK߆^/ҥ9|H׍i4BFp޴V3ڪ%;Ҝ9w`=jhऑBy6k5 ֺ4zE栺 qGTW[etV"ÖzT&۶&n%KaԢ @,ڪdQtRP)PrH fY]0.Q;U-"ROQqFlWE4 ?6sSz0i_͗⧈.Te=?t>(v6oBy%&1Ldo ;W jkӾܜ=BH*F@h&FEm\[3' "#♼ُt&kt' `5sO_J?aVJ1UGP=6-e)Tвt%#;ỉ74ԮopWhДئ;gւn 7}*կR UE> oO }[:0+@t^e}ѿקQEQEQEQEQEQEQEQEQEQEPMTQ]0v6ӑk ~*WJgpm#)qެ]Khc7პ*8eIl$SaXpH*S/"03.Czt<(ɖw SD7W`pGo[\LKP k~5pa]bv.txIU^H 6;pNON)Zm_05F|aoY,$*8䁊kM䁷v 8jd-C80Gq[??{I-īDG (T2iح(HAJzFf1wj"&`XN,1R^;5+=f; 3Ay,cTuq;RKG$SsL)E u{ 2GM'm['ڥ mXK1ҵt蚷Ii<m⡸Rx5O^RK׾kK#rZ\ vHXu54ۖDڔ#Gt5zίY(˿5kln >X]jKXZeAB[ag}Kyo^3AD^g;qo[8X̐H%x{⏇uحJ"%U?1V4t-'@pOQu矻NԭV ͑ڥĿ xUMLC- #סL.m$TN Xb9R~Q;nZM7BG'6$FpHB`/\g\ƶXJ@9D~H6 J}7XT:}[FAE pk9#dH}2 4ۻT:]eqsO'L~+i?jߒ~^iـp΃qKN$f!_jNjsKJuK{Dqfw}L~tV.ŻaHkC~"N ͔4c@=vZNbnSeMɜQKKњHVr1E-ўWsnH_-夶n89V`JgW}Zw[N s|1j~er֓:jhoF<޹p2*3w|D^)$ ;)_|-y_P,Y%A 9}%6s7LB7aFIObKd_4 nIRu "{yv(pH8;w]ź'pNicBBgLXep )__j6uw\G1Thm$+GM[X3$TY Anx@TqkF[#''=j ->;[vpw6*I#0AMԭYDP$`|I=U6 ΒlFU|c>M2X*Jr=%"7@"vp 6|7=0kYA:GtJWҮ{aQёޥ{۱>`Mj׿cY4&vx"%|x r8/v!x>\)qd : NGTu>keY  9`讄`Xt B1׭MUD!8~+|qVŬfd zNf[x` sQ,' ⚺}8U#xz|:q|cnƞtۀnrggLUI{٘HUo*xZXMMJ!Hrq`0)7obn` JF>ܒAȥ-h/FN_RׇFK߶@IV"IJY \ -QF'p灚tڅVpϘH[>"kJ𽧈n/eጻ9926kTd`{!!ltGfL8֦|ui ) RD|>QjH.$6L3N+N469H|7t~8-29t˖*#] v71Lp8Q$K;UI SSÞKFWd д΋Ame@nc~KqMjXnUk[ӯMqhuzTSZO ȂHȐOIQ2+/bDc-Qn%+8" ԗuŤpr)\G*!$/^),{e*2r13<=+mf,д)8Z/tۋ$FT;FZg͞pY8#OY.oc%0^d4r+ ذ2 )9Tgk~EEMiC%觱Jw"@SU3Jկa1B8VWnp>*;٥IUo / xynxS+y2a*,gn QP6 c9̌3ӥaq5kCe`3UfIRC cHb*m2D`1x㐐j|?Vfs9w;jʥO"E+';Q_xFoэ_sHm𮌧#[Ǽ_^c}?ѿթ* ((((((((((Q֕Ng֌f 3ϵl|Kz:𶺹$htZHSr,#'5a4qoWlUQ i%,DXt}GZ}2 g-@H׮={­QӚF DZ3d2GlV1FJ&cG_:kdmZxXmFYd OzJҦXx?zO!>kgΉ9lf%g[z˵K^ Sp3{|HE]{UA}j@I޿棊tM?L|gߏO֕.~6 *K2Rs04+|2Εk,{usw1w y#Rg a4 -+jJh(W*@M+tO41hͭZ&wK2ZYF }Wc"1.:qXHE%-$Ҟxw7}'º\2Oj8-${p3[.5ܬ"@K;=Z$ Rs?]Û a{OECV@$@pΩ ތE8ؒc 墼cYRjZ}YGVrZ +ĹkRPjmN2ySFe5C_1cVl}s\ ֠okq $nmJ=:`V]7Zyy߻؊\}sEqRO.Eg8+v_Y7Pxr0y9Z?2&8+l"6!nthmCsx턟֓mcjڃyb]X'=G-wtFWWڥ$_Ϛȗ1sfTxdQ\,X:޽ g&$tC=$y~qJey'n4 EHU]1y\ɸ9ARM[F#8կgPD0}+5[G qZrߪĐ=r*"_Gu 9;sSi|d85qvBT|1dV'F.ŜZɯH]ZEy>U?vܣy籨}RAlw,Q ¨uD"G/#egrKj(U p+ Ag)xO>Դb[_\b!Gn淵+Xc,FhVWl1sKdCɩT/To^QGqzqEܼM9H22AMηP<{⛽3@ZӭmIt"s S^ǧ[$ fdI.Y#.lK;MGϙ#⛪kk?l{w¿.? Xm>&R|Pȧ"~T`zama6 HKcs:%sm=эwMU=]j0VUsRdGn$)Uny- T03Y˩Aƻ '-I{U.Q=MiAYu`i HPFFjK"Y<_B K}ě;2p3*mϨT:j݌e/k"%56I5V9@^?ڦi*^ӭf2 H+fyGKtFݪ2ֈAƍ.&vnD{[ПK4ip9g恓Z u.oqfX;HI Myl["Ʊ1+8F62*i#[X]cf,39i_o-t۹ᧄ&[h4;fTN:YAJ T/nw 15[.3Xsg.7<9OwaisgM½W !#8QژVT"#&i4{IT !O`kQG_ jp=*@SyhͭL9`[ԁL,g,.da xW^o-ukCB"xX: ''𿿥xK ZUnr=+u{/W]׋u1wut(OjΚ5 &lZ"DՔu Dcp"F_͈&[o-6{qcmc?:#ZdW9䰂@9ڤe{  $֯i/1Х4cKkZD:G?S$؟*q<`Ҝn:[H."SU8 "ңvRd K; J(ky$>BEX2gk5i*ľ3SဌqնcjRFZ#Ԫ\I t7ϞF;oͬ_Ik!SͲ߷mmEnD.0}`xwzV>YٶnVAs SUbtA+3;S%qq!H˨]cޡc>e-Xk|j(y`GSN܏AK<`\̖#}}Uk[i3 IFdjsơ&$pm(϶.ۭ"~_jk6"7ӏ_ !l𧓐>'k+vX>aM`X<6zb 2V1H~0Q_C|.VIiB)$N?kmMr5k'7|`juUR((((((((((CNO>:x??W~=tw%w4Z5U4! n%AqPl˂yt9P@H#m"j6bdzf&PJ~b+g͒OR+M.XWRsڝ-R:bI>aWbq$s\IƤ0PAdb\,:a*>Rg+-qா0+/75Z(((((((((((3bݻ۳+TM=Nb8D,rv(\SLqsKӥ Pp3j@+/]5 4nlcsc'`z (ؙE36y-_4Gp׎"2 oI3җ>C P 8rv \TO%rs@ڹџ\R kq!q!V?(,76=2hp?* \R%l*WA_Rcsד&`?*R9 |##-I%*w،l}MJ@8j|#lYBzRd=hǭ!PxgO Rށђ:> 6.1qLv%1Krh=J@8ʃQN JaBwzXFoΗ#IPh ڊ@:"¢K;TkuJ2=:Rn>fm"(K;X2[[F76=ɣhW1pDb"=S` b͜bzg`z ((*eʖPJl'O<hRlLb* ۳+N7:}Izʔ39Z`75r@7}xrxJ09sIcg|m2۷n;sK`b:*imnlA)Yf=@?*61cmD`9c]1@͜l01 R@R P!8@$d9)6?*׊i!k }9;q4)U++m#})L-0 dpf8U@)bNI$)61q) ( -vXsϮNh01JR P.#5PN7HNh@Q1DEq9;.OA$OnNhs׎,F^9hqJ0= P1:qҐ[@%Qq%8Q9=)p= D!`)᣶FbPG)v#q aQq}F F,5>sN}sK(ڠ(BŒ!\ zg= $zF qK%y`G1ȥ pE P!89!.OHI=I8铜Q MLv٠';1/'ק_zR3I?* 9* "%2$#"8){ tqGl4HrI'сb((MƑsPc$Rh(QEQEQEQEQEQEQEQEQEQEQHq}~5R4c|9dPэŇR1ҺzO["RvW]R3LzJ_z F+y q?4rgx5]8v欬c0[k K gh]R֥Vpr*$nyQtyȟ(5 -g++xiU#䞢*)^O_JX-\,!q *av:rh[#f_Ư< 1=,vu'PtWtok&J((((((((((((((((((((((((((((((((((((UInd7f5fE gGT.'%,-Kf1aʣr+h..eeVm2N:c15Id]|@'͞sА=+/{}]>͉wW*5:i-b'?1Wo'֘nmVNy6VK1W7`1Tf,7!Menܙ.#iV6n,8mJHIaq) Qzx>Y |$谳}>Ն[C%RnæA!0y]/v͘oZ"Y 1TlH)4߈S{$ndnJθ MUƒ9 *jk;nLcT`J6=qZ 6+D$m|=:nKx km1bq!Ac Ԑ8˻sUjMEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQHq}~5w ?>&iW ]z^#y+6:!y;u,6z+Ao*'*J堺1 [(L?uZRVݝ$CQ:  *mpg- T2e~1c/{Y7)ʞ"CjF{6HoyR0HGZ\&Trc\}J)DʕjdqbUᑀNsg0`Z7*h_\ր 3^a x)2|Y\4PaEy!CG4A҇G=5>NFvv  ɪ ŬĈF9JL7<Ԩřo}*:HXB$duhy `1ST!F I !pܜ.hy$v{tBե-LY#B}OT߇)kqA>5·Isg`qu")XB(gշT&49U*HwBT}HY`x^3>yF)s%iԂ@eYB*94D.cVa<ϾG4ٴ'ϝ2OR&(d8kEcv={51p+wÞмeknR0e+ 0>djOe g;I@~V횧SQE(G|QEQEvQEQhE%QE%Q袊1{Q4QAQEc3EdgQEQEQEڊ((8Z=}((EQEuG|QEQEQEQEQEQEQEQEQEQEQEQEQHq|}GC?Dx 3|kkr#\}w6͸+AmR qΚ `̂`V2&uGT/=/Ox&TDTOy}isVkv) "?CMF;ORmk9lyfj &xY۸Lop*ݭNu,.-o")#H FZr-v?83zZH 4G-ֺO7>2w(8:3N䵕d̃S|?QDvQ^/|VbW'Qc-56CT "Ny<ъrFHޜ|< ;rh|5F5}M},ா/1MkTQEQEQEQEQEQEQEQEQEQEf7R[i>tk>4@[謵 6"Kf֦kK$љ"\.$*UF ''SAq WYxeggn WMlmpwmJ@r,28H 30jLg127jwu fG6Mle7K$;Ҥm)aboI ;T"jb."јzM1b[[i-PBO 'ҜtfipKUFsIp^0^/a۹1‚=|Q`L+@2,B삾Ѥd$ u 3gڗ\/Ɍ 'QٛjƻdM^5Oc%ӡ6sa_.OqS%+y/iXHON3(jTH,N\+ZڲZK,}ܷv|f^"J혴ȨJN{\pa@7 5NHocm{TEsB68)4|"y]E Gk}2BIyn3T/R/eP.衷*H˿ N#8#,rX; TWUAXIYFH?ʵ RE%,?_3@0ǖ 69\FA@UHeTO8]!+y9)L A+ߌTIffoh !hDRC㍸3JtCG͸v|w2$~>aEzNvmژȚ%18uv=ǽfJ9NrU;7Y2j0IiGy& :OgCu}m1s{sȭ[Ke>6&XF w늓Wj1]6w8J<)PdAwiL> Zs/8dF64Id*3|A(Hxg 'zoEΉæh!F>sޛo$c*2@>\#'XғI̥ۺ3U۹uyl`ֺ|ҢaNEHW*8K*=E"Y7nSQqiqj4bj$ M&3u:)Hc*jݰ2 'ڭC}݈|T0,p[ºǟھ,]#=!)nn\ UVo3{ Iͳn2 j[ir`g׉@n%t=C; aPZmURű>y|݌p*0 _0KA$4W%Ծ\Qȭhb9'Zm(@AAqQ v|$Sm SS_5w:t o5Ț)1('ǽIsB7:+Q}Mq D9guޭ 4ǂm6IDtGOrHIo7f2,ČMGbaNzS̹8f;U'ƭ˪Yno+(..pH\p}}iXT%^@*ͷyzRkAQӃH~/eݶHSF|p=}fI./]"xv cLQ"KrF:\oFM#Gu,R6*1ךq1~$5boAE<#G/wyHVd!]%LV| 7? _aOׂ"‡igzG/m42O7j|o1뚯ce ,C$㞸g 9i&+ w|Qi]NL eA$d(.f91A!3Q vl 73W$oM+qgq87pM˔m#OMM102#88܁2ܩ8=U#,KPs&n_\ լEV0c:V#d~o-2["#IC,@ZF܉0ݐ Mt7lmoVAhIhmYdgijˀcub8*V*?xV.6'޺?-–Ɂ.^lgzkfn/vXڤaA}j Kv 1rן#km{{Il>7`AQ FȠ뻦j#vp1N u \zshe]ī#5r.#`|M֯4{++LUh&tlmuN:Ոii]..pirUR TSĻ,~ymϥ۪ɦ\7Efb \SӇSrI+Y^8:'ƸGz}>4Vzd1[Ar8j D%uUXN3f%e_,[]GkJ[WYġ vL&iD~_ yJ,ax Z\*RsoP6ⷋn/m&՞ɯe "sMl㕣f<MM-ԥ" J-KkEB HWwiOc=ȭaߗJ SRͥYgdE8(I~˃|F!f sW]OKtzDӼO&ك 4Hc3*$ S搥BSX0hV`*WIOʑ7 wu 1haĞb21uh|ҧk6+K& 'n¿g<'um>|wq#I~^>fu&dq ngny]횵P'=a6`a7>p ǼJq |0.:Km)ۜf5Vټ1wuGfsi6[KO[lv'4Y&z)>Rޞu.d1vaU>%ڄkF.-!Ǟcc)t)8dc=r*XLk]$GrJgZoԾ]xKf9KFp7ME%ǩH9gle SQp0=N3Ux|IoeK4U>|hC=66p9\tKh@T ;9px~K1{ ߽Ei #kF},\_\o$*op*w&8#,7nyV., ۀ=~Z#j7V^!jZ,P\^Lm1D.pTKkʥ=3RܱY` 9~*ÕG eZ'M'I·.+M7>B Aǿ[+1݉^EE |˒NM1d .Lg<`gjGYnV,g ѱ{&S4H-!ٻcuuzZ=J'mo2E9J`85)C!\BBVb *ΙF]B{p*Ent'*$}yɥy{NKyR,itX&T}Uh4xAχ5oϩ`W&2~uq"6"D@&q>o4+jv5J((((((((((CNC(E!k'4?+^EICMk;glpxzf _ʺ0r*ypeHU%8TlI]gOG'֛'U'N ab{-$b?C{ݶMFa=<9z`1N}B奊C)ڧڐ[/ riEGʧ8,yu= +m\ C~r>.:)@1A2`Hkvvb,-¢q!@Hi $7^Y4n<.y`ŧQK/ڏ.DpC z,Lc1Q-ﷶݼjemB$0n_ Ems8r1`"$AWyuζl8_;rzR7  9V1paf, א0iP8P1ӊ_ŷO\5"Ym~% kۂN}I%ĊHI7(0rva=T&]f5~EN:e% G#ٴ֟ol< @ wÞAB-H}xRsL3jnRY턾`=xN/UK$) "|/NAF>\sJAomytUGp6m/,O,ry30E9UR~+j7M*Hd!'ցoRxڭbDpj;&?jsFF600@!"q$i-2X󩐡E.0H^gnA!{H} ojfVVK&`n쾙4nWnd.̕z g?)ޚmECڠv=)^kkFqO1+*{xvylYJjGL)\\`dciZ3};Pu]ҽ{MGoP[xMo!'˔qWKirӸ@ G^Ə3 lwnwno.A9ekDhaH/.W*7Vsy1r2q6VK0_j_xrO:,<|-*p9*vN) BFlȈÒ;4M8#Zr10x6(аHC;27,0Á)-zmwɧU(Kee @$ 5h2e}g_*/C[x-[[6x;{7_sIGۺ :"FI+9\T_~K-#"値x!ҟsxlt (H,S>j| LId%]J$dbDEڣxr2YH)essޘ4^S) } iw%\1)\,h($3qH`øh(c0xKEǨbcu@0E.zgnJu Ts[0^A^Z$G9=EEkHەAz ]2:w،g} 1;OnH.V<.̓ nq(ѸVBYF0>+מ#BAZ/|?=2D8}ݧwSGpgW>i${9F!_tƱXJ[<E ȐM)kUy%,9F4OFY\)<8'9>-161Ү_xcH-[] !>R#iw4w 26$bI>hG:QQȎ* 9t ivn {xBcsn`E ++r&Bg3m!\MMv]\A$WJUd `G([w)A+R߂Zg}]Ė9Q|8,mWLq$3K;ڤ:m6Px'O'$Ack0.dq)"?o r_<9]=Hރ}u}~lA09H4P8e*~nǵ2/.#@̦f D͸6t̥eX0;{hF^cneYVnpz N偙I qǥK_%9{fT%u[T/HlGzYaIN\di>\) 3/4m+# w}}S9f Iz"0 CKqi 7:|A-Mq kv?1$>oy=md$9u? [{h@{'9<9/ÿk:\R#]3\$R\Ks 遌QKv gGm!3՚>xu-bXax*Y2:yKsF.q7@mN;Z<%p]1ژ/g۷~gswU-˳(P"'wr[k7zΞ֒-r$l;@:U˝St8C+`:+PKۂGN4PnH9sҷkᘢd[9i"yF pHtNw`m皓cOPzT۬9nFOk4 JVCwn|w|rj.{JF)28ah-,X?xN Bz{O"g'v=>JWQ%BBu6jp/j <)-va [l,7" Or`b܎i6c{U`V1WlWEhVń%vXR}&E<, ޞ,2WD6?թU}k.:i͗>&$0%$`玌;h1 F=S`V` tJYGm7VXHf"6+j &˿go\[n23Jlmvnߜ$W6/MȼȐzd@!6s̛gw^]vYxi"y.#U0}SSW-rT)JCm1icn@N yd>fX0Kd4FrABg1 /+z҈#Sb,bR '9[߅tKs. %ʢJ\A>ۛnUb $1ӣ#$9=rjjܪ((((((((((G40Q֐5A(Y S@Gy1xk4Z5Uf9qv& HN>nOUԧ]JAAzT2O ͹HW5IgxT7PSH)8H%_׭_ȑ#;ORr5&n$t 9[nR$SUtHī9QWb}}ha&k"Eex~vI⾾㓺3)( ב| Ǒ\*9Т/rA=R'[-uV)7sGhM6"՞2rqApo@lp@=걈F]I.GV؍"PaH)3T+#xhA^KX\ m$< ;֭6Λt].|(ɱSt$Mu dngjU/xWD$t [i|dwFI.2pE9g_qcKyH 1 QOݮg]{X-˦|[>31q[4hȔKYG0`T7:2VXo%qֱdcHӓMo je6dd-n$26q&#p8nsjWgwެIն`ZK\& ]&̵71Fcu_8F okUB3# *VФ m^ _}jkvn1מMKu+ǰ!ETPVcT(s\6Iۭ6l#>;UtWUPEN1qB $c֭Rۼ+ 9b3+[ZMnfM.2e=ꖏis41\asϹx3M3Nf}B;D5Ko\GwsiO2۔18>&eK 'bZB UsZuk*QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER?oOQF{wȤ= }DMa|U9Tr3Y="t88B $1A8>-[546L1 E5dܡ84i/ p[P\vx6b]O!Qbbf,Q_xFoэ_qxQ[GeVWin1MjS ((((((((((((((((((((((((((((((FEcU'f\[A+d1Ӛr»(8 ¢'xn{Ö:ޕ=tL $c ;Ktc%I)FP𜊐ehIag A%T4JBA8vZqU=@v?*׎~ sdt9\icfkin#pD`:1/{dt9F01-b-FAF:t[M4ϰOw@ 2N*[{`WpIȻH<{TZ` b"r uI=NiF1(U_vSᶷA16ЙD vԌyX1PXt8Rmo$4B' # ,CP B<03 .$b6iFQF94ܐK#F1R\j9ޕm-í # zo|cscڌABv끊tP9o->M KcOJQAm/#H=Z~}!$P Ge BaEK=Գ9cMztTf#RlN~EkHXEYyK?ƣ.v=)G<zKpAUZVt^Yq!oq;qӞm9ظ:v ݿd۷f<޻zt9zѴzN$\).m.Jt{Ro|z9iOqL]6Dalmpq/'?~zhڼ|jVUaPЌԷ]G;d@?CHrTP@#؟_ʘlmsinr9ynݨo΍R 2fso~]OsT 34+2> @U }[b tb0XhRԴZ((((((((((((((((((((((((((((((G4iC_x|F6}EIjFN}E-zg<>lx+ |X~Ҋ6>( w/((}wRhe3^5V}cMRѣt{sд//8N*̐:"? 2M?zz_hM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/G$4@yiG#~ThM迕^zE| ߟY}Q7TAyG4疛~=g/GދQ _>/Zoz/ZZ=$0b+gsg-on%O%6۱YO |`՛Fl״V%\((CNL\zHz ? .q7n5stG^2򮊬[`t.sJMa¹B $!\hNOsE8UBXA hE0&n8#Vס1jt JѲdGz}\cxc?SL>fB9H⦾I_X$G K_,bX% Ҽ@3Zةʼ p(!1;HpmUpx$qVM-6ER00y>/bom"Gm0@'(8o# ܉?[⿈UN誷)lIyJ@pQ2F)F Vbb钥}.-HcVHrzө'8A9o Oo~98Ñɪ:Ԓ3뚐$@]Iő'>t|+u>N6ZHeQՆH^H]r\v8ol 4?Ea}^e}ѿاQEQE>`p:EVЫz[lJï ֨EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU2lwkK{ˍ=ǽh蚚iW%tٲ7*zr*ō\dclː=rZb>%*Gu?WXn,?x4uyEkkv4K6N5Iuk :mE*Sv|FCk{XΠ"wV.qoX[Pvv"ԴOiiT*YaP^WS=₪JeXs>%pכŤ?d}c^Hvv|.ߏ8 F+֬CmkQ[ˏ5md+~kW_},оUO)< VUX!c"\/֫U mAEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ[~y ]PWtrէEQEQHqy~5g=.1qZL"eݪφPw6Aץ_ KQb4lƒǚq3j2bX%*9>CNN3E,# <]$* rjhg4Q.H*_OFo](( 0SHE$'[ڠ9 y($ fuU`1eLhW[|Wc\⏈ĈsdVfvXcr:IږqT^~dϸ⢟psV3,I⛥1 *NI&Hnir92(S'LWSFXpE5^I/4>֟B9NOlk_ m> /vA*d֭KPQEQEW3OF][B?5o+*OZEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW<^ ?>O_'qWxgijRG/ܠen$|3հq,js ZS=@+袊(((((((((((((((((((((((((((((((((((+oŸ7ֽPY1VݮZ袊()7ӓ/Rޤ= }/43 $+់QJOkr|?z^\tWPtqӐX\1N WiJLw29F;.MC.39]<皏JQX`V q[KD+^*82.y#R8sQh%0Ry5kH$('](-WfN5X~K]/[]d#i]o*:V^ 9 -kQGEA^tq3Ldq֯Yh㠧q춌 [P1sv2n*Xo\.9G `TVr–I.Ѫ:@p<qR-17e1!4sĿ0.XF1RHKg;Gjż[cWݾmXwズoo75Z%AEQEQ\ϋ??kt_o Ǭտ:=jQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ^?'Tq}WxcE?R"?1Y?X1I77fU=tREQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEmS>s׸~6??*wyC^?VQEQE#rR(G֐5tAiqdA:vWm*kx9Y&Sp zVeY8BS-~Fs׸~6??*wyC^?VQEQE#TXZ)C_x|<+?Z> >T]ƹ}H zf _ʺzXaQqtyQJME+dkCԐFb$NNLbr 6sಐ^MRcw+F:4L68 #[LAgJdsEGjl.{qW#A#9b8hs'½㬂O)+3cX?Pj.cV^?du p1&l힝In$2p8MX-&y!ԜoJARBI$1.+g<E1D 3U%uǎIKe@($ R3Ȧź2Pu#z[/ҽ{/ijo/~$UIյU7TЅx|*+(((((((((((((((((((((((((((((((((((+oŸ7ֽPY1VݮZ袊()7ҧ_(Hz_x#'uLdKӷk$"b@3Jes_] s#-Dm^\OÞj5YG,p>;dҊ+SS)iAIJ/jiU{>Q\l$ Ozй*`QEtVPEkdOW1hw8˹$εvwqsע'=NvߴmպOݥu_4P>~ 9H.cҸ$dl,V2¥,S<$3y31?}*i8Fcj19Aiesִ4@&پ@dCӂ–Yb2ҕ cнQ.ϩҘŲ/Xw$zDw2g2i޾ Xhz^?!$? h[(TkNm >?y\FfZ((+g|u'c#.^WSY^[Q(((((((((((((((((((((((((((((((((((Ҋ+ݼ"\g$@Tq}WxcE?S"?1YjX1I77fj+(((((((((((((((((((((((((((((((((((( ZCFgX^.(߫OvzjӢ((CNOZQHz_AMu-ܘ16XZmNqryWi_ kݮ2͎Xa ?JEt+6vʀQX"ً_sV!zgފ*֝Ck9ji.zuķ VsҒ/2S!G+3Md$W*Π0T H= ̟|LXF? 3iSL`O-(֑wX}Mq6Z]ӦEҼω@vKcIޞpum[i6VLm!+P{RZ]HKx`p:EVЫz[lJï ֨EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU?Odhmuƹ z'H5JT] 3ӔqҧvKH$d =kbzܪC!@ WΑgH 5˪*9?,lµ-<- yHP?{&f,tkD%0q}AXEhvtr[XRF3ՕW[ ;(-$D3_Zaմ[U±#U/Ğ4"{`A7)`u-*6Ƒ~V#AU7~ ׭d*l$∆iԾOAKwWJ5yφ5w*l@?2ǾɽH%m0q\Ʃ7fԭdo.AH85wk=U/8R(((((((((((((((((((((((((((((((((( ZCFgX^.(߫OvzjӢ((CJ޾Ry"'W^5k?m=\,I޽3Jes_] >b%+eĤT]-eaQ[۽ܧ?+nFk? dZ С==""4Rj_4P+kN7VVBIU-&!}SeH*8(̾a@_ֻύ6|X ̑d3'Һ_@?om>JL ԝqϻ<8ޖЖ Sj0T7JJv=8"=B泍*B`iϖFn 9'D; :SD~ ݀9dʕqpS{h\uR=8 ؉SȩFz@ozT 0>HS<7JcK:^?_{xA ~Q N-ap*K.Z((_2~?2u>YXuUz((((((((((((((((((((((((((((((((((TvCfSqOY!b; V+@>̧*c/5/nӷ}ilG/4}~?lG/4}~?lG/4}~?lLfg9v,}IC,JݺnrIFiŎX}%6IEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ[~y ]PWtrէEQEQHq>J)C_x|<+Gk) m&R_52w1`Hk4Z5UF}LWezsڭQ\ͤ^\`[.y[-}HQ]<6BŠ8=fu4EG Z D2͎袧Yd)Wq!ݨ̛GDE!`;wk_[c2`4GcҸ-/H]nk4Z5UOpb K(/Nj[&А$ u# ?7;~f[ߌ^#LJ>9@S Wq-iCVQ<X}Ja cC.|n֗T8_\˻ 69IEF2ֲTȤ07t a`@QE(߻$;Swng_ҼwT7Z>u=ޏ+z?uOq_ҼwT7Z>u=ޏ+z?uOq_ҼwTPƏ]wJ~S?4oG=گ\Tn84}{Wn?I{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮy?G?Tn>}{Wn?FGۮBI$XI4(((((((((+oŸ7ֽPY1VݮZ袊()7ӓ/G>ȉ@?4]cH__+ɶ_W-*iZD`;\ GnjMx/tp {IQWcÒRǾiȢFݎPhK,Ŝ (k[y+#1*E9WGecma$ǒVk+{l 3F0DI+܄UD֊D YyĚ?yqqG (Bq*73YqJ9Riہ+v9޷m Ekr㝋ޘY`uqS{{hAQ"Ϙ'Z*'HY),??ξdeտ*|!+3V[Ұ«t4QEQEQEQEQEQEQEQEQEQEQEQEQEQE ,b4[s5vc r!QTuZE{BAC%cO`My'/TѾ:kb> AxdoF#}Xe.crvw(Bi$u,VF|"޲k(;^-ߋS a@*\jҿr(&ѓq?4)S^}M %QJ q/POB-xQAJr IjzE/s5]xwᏊ<xú{scj+3I18 C$N0@ZƒTnm?K.DJ $kFK=Ią q_9U:B18\hEQEzGS}y: 0.=y {#y,v328eI4#;sMc+è ͽ{ 84!/UZJEQEQR4)3#;[p{H r? R1R8tRQEP=?J) E.~T`RoO/E%((*垕^N?LRcT^[Ap?I)&Bխ}ƙ}z ctclem۳z =2JԡTR %P'}$@RoF)7󢍍уIE:((p}@SKP}  &~Tb(G'X4b}:0} #)V*:1E8*ATVv Y@I:I$;ɭ#dG&w}ʗcwTjVejoc?g gIdFFC BVQUPsQ0*pMIEQE{fgwO}b~MW&NcAǪ5{bq{gqne "սdu "T((((((((((((((((}p?mUk+:((G4(iC_x|<+Cu BsL}8Os^2򮇯qڞ$ #<ݩ 1`j 2>,DqE[T6Ho %+#OP2AGn_õ~R1Z}1z -?wj6cs\U"ۃ('lz)48v9WmG-?d<$~x=r|9ݞI>/;`Sa8PsZB3Q[q +鯳sxT)2 }rq꽏d}y/|uC!'Jʇ*?V8++K||#43\ sRDCU"8:*I<`sNXBw=V Iukm7LpϠ"`}B :kf?ʥ!KH -n?6V $ws izyVs>x_y/k-V׏Z~"OybpTk, |-UQ_>:5tR?G2ve?ӵT3a^n_V<~*ˈ/juH41UXxoƺB$H9D+{ [/4zBn%'>;cYT]4cRFGABTqPQOנ|.xCཔiݪKjtlD&iVw^ndMpIFC.=[×éĒўTڽGFAq%R-cC}:yrTz _:]Hsd>?*8oxrXv*SHHo5 Q}CU0_ZxgPq^q >yC[Pdko9L.9\t*Oj#SbJ#"E^55 tcI5km7Lp>u*f :{g-܂8"]ƥ[-#^ŭxgemJGk L;LzV%Ui:Iiz P"8oǵt7Qxu3^jL2Kq7|my!a\['j$QJNw+gL2KMfKr6~;,`(ߍ^'b$^ӘK{Չ9.]~GTpM5NrHϸ%+w (]_.k.Xկd\~fpqQYjR/9SΑ T8lQM 8ǧ#Jij.lӊ>8W⎾|= 9,ױv?^lUQEQEQEQE;[6^⋘K𪌹^W,mi^57FpjO|㟸rkYMxSԮN1UdbX55iE@%\kksOڲipQ@E{'tɤ312f.EptĻF'].PۓקC3"olSpbhMnF,oI 5ӥ֞HדE<;mvo@29L}CyA[xa\&[9'"aYIIӨzj~Լ!ͥl9Iܕ;2mzkztw. C\Nc>t\.t#QXT<^~Ͼ9?ՙ*<-O E]`OWUj'+e ]/ZM"w^Vyo-BIn"&;X \ԖvD#_`O>wlZ{V':Ui=zNi[ZBc0\su,X}6TQE47S QJUC €H^NJ7h3w!=0Jr*0g5 iQE/7}{*y^GZB5x{DkJ^~: QZvep?j某$'/Оt4H7N€9#% I=Z VUԒTr 3^[5el~(U5L./n&_$ˤu t xwЅ>ȯ׻*bY?17cP5|t* 0UT $:Lrxe(X`pA( Ў֝yd`>4tuсS Vu54 ?í2K=BE|aNGZЕE*FWρ? `,ɪI%͞ aHɃՉcK4Xs}^Z}wĺtť}1i 5-i=JEQ&[yYܚɦʂ(d wHw?ea )ʬ9Yv\?1.8GhuF8#]:'s@L񵾧nT̐km?RhP$w!ԞóZJŚM/ M'A:e^9Uv(((((((((((((()sk?euax<~i? N((} *)C_v>P +cW?uTqdIK#g|W_ k=:;d`Iq$ёW;\@F `h4kɲer: :C9Q'EGn͒sOLEcio^yy;sU#@4Q],ma[k?W OaEc5/:p2ߴ ~6Gψ1ebnEy~vcm0\T2ȼPit}./$-ba受je@lOr1^#7t^>y퉗>l*˃nbh.fUA{dl(H!G~+e*̧$IEQ]@⟇|iRW?W? zo]ҽ73ypG"-w?1fEP+k6?+¾|2*}Is.igMV[4WGȽՇpj1avΙkiY_FCXV7sXܤ#J|;N}J_WKna<Wtz Wr 4eo𯗼[Gš^ x 2/fS"4lU{:tw'{k,x.kC؏Q^-=xyjy/r^~)v?m>ҿ5Zq\}]<Ʒ#y.a8̼1Wm5? HH\}%䑩H3Uъ=5DpzײFHXJV#LRU忶ViTTÛ#=&R[!1ǗixRgm`mRc&Vb03׉Dϲ[3BX`Mtspb'=^~mM܆LǾ8sz(%3.>cvyJ %IM>Cmq+SI%M63塍r^l:a{NѧkCˢک<2¼"}:W娢+g% ÿ)OdEWUC}BKFG<}iL0_NnM(nk̾h֚hZ- fepcv9\~.؍ru/ xrm uFцAQEp7ȠmkO5RYPnI!en1uND'+^AMVrۼɝzW',Ow W m'?Ui|9mLϧ0R>i!$RC+D^GbxÖ^"du2>qϾ6ׯ4K2M" \ZpjW)$|,/1L= vͧxȣ($TQ_0KM灼F}y_c8%hY`^%]w8{ԕ^LF; HR\{,zд(r3(Mj's==sQEfjڟ82cz@84R;Rptf|NeO|l8xT%̻Oyu-ވY[w ;1cI5}T*YUZ>\B706lXyTAT|8?J)Ș)Ӵf%` {6F~K ) A洣v(A&T(t Jcg1 R3Kv8"oO!l?=ap*d֝IPQEQEW3OF][B?5o+*OZEQEQEQEQEQEQEQEQEQEQEQEQEQEg+υ'#?FՊ} oa'1}F9EhA"^!M"¾'Key<J޽AYS˕OR;7_7|FNzK+grZd4- yzCg9n-V`cLK1J ?ƹJҨEV߄3F4P[Zu,sQINOw=j 6'IfHQ?XZ]rUR6LkC׋"~hx.~sU'JO+n+M{uXF<x|qj.n p8 yd;$')ֻc.>h)p:79u9T{g6+j( +ٿfo=׊.jwxkh>?ٙ5~!Ozd#ŋ][160om_棹̔p+k+h^^.${~;J1/ȟA޸z̯oM߲O>db>|dw6tȇvBWko&Լ'éCCe^øG!ZVՄW7=YfY:= }5q~9x <,ڽIKi?}P󚿄хym|97Ma1a] ?yR#Az}y]&A#]/Tɻ7\wЎj ԥjy S5?zhmƟH`ExmUCW~-Mn={(;%$y`1|իOZόjvYF@?u% 7̄xvGkVPj.dܣe:r>(X}5xs%U8^yb+}7Ŗ<#?Yoj3hF 1/>#״@Vݟ,8U??a OVW|Dm|C.|9k{>YMʞz/_iiul@qy-闍 ܩ 镬zU/]<8_>I-U gXzo! %C\_/u?JYY@ܤddduRRHS#9SX}{w2PH˙RI85.z tHʑ9 2 $0 ґCtr,$E#GdoW;x{X0*qwS 5XeyAz[;+"wia7/\!e²G5rn2B[xXRLI=b]oef#3d}lU׾^-wr7-Rǫ_W,\13ȯ6Ǣ [)]_uYllo;ϯq\gǯKf{wO,PLTWq𞕽]X1;ZUVoO1އ{ZƢ(d:._P\L||쥉*͌{(ަ ";a6fMEbǦH )ũZk>Ij;<ɉhn y.d{~xP$s|Ƹj*̢(((((((((((((( ZCFgX^.(߫OvzjӢ((CJ)G_Ɛ5wÑ'q E|5EȀB`\6n|c^6򮌐5jv cE}0zj Kh%mƣf/Gˊ)jv NxR9#xk'@#H7sJ]'ҊZ5 iL8=z* Lt11c\~[< [BlCz[a mAHW~L!w__zFP̹iSM._'ҹ=Ci%uc~J9sSœu/Iy'=bژCFÂ'VS ]᷿5f5+R FlZwpǴ`Zn-,͸ю B񜟘Qǩ]Y|qE,_4L<$= tmKG`۹ǧj|CiiMn,j>ƹSᗆ$i/E}'HTm*jxU:?]ٚϿ$\CjS 4Zj[ORjZВX}u^kPknnc$ ZnpXvg9#5otB2 ם=y> 65?&̮zP'ӏoͻnsRln|rBHM'%\\шh$CU)*jemxCڗu="c)/uaSpEQMgN{+F܆PՍ>m>gl8;05_!^9O1cGGu2 \w/yj+8-"taƷ|KAiV3a!/8UuVHHD! HAsޑ]Y]UՆ B 9vvo'ҿ X Bk@}5j+l#yֻHዟΧpn'ں7 f#GZ~ xL2|ei(~]Zi/ikZ xOka9˗ t_} n-›u2U;ZB8Fj2A=TY/xofԥHaYx@$޴O Ƨ'o xgYjGh+3ekV]irP8`_?US^ON9NMqm"Ds_sHN)6șWiPn` x/@j\J 8ܨ2dq8IA3^Q}Nm#&b!Z4GL~5e6M|i0ir(,b@kf'w ݩimv̽OBLxVu6|ݻ#N H^[{C*e=4% XXr;WO&_i eWB:gC4{e[qS֍߆yj"%ÿֺtcOja^+MLɦO! nYEVtU j+PڷM囑d?Q\0dy 6Vm:ֱX\ &>9W4pPgx[tK +򏩫>HSPC7~g>"Ebc}"1FVAu SmĀ\OmKgh70OB޷A.,Eu(gcqP#2U?eCxZm1Xؒ76})ϤcҬ-aϙd}4B +Oޮgc1^\L<[5[MbxN7U"9d d ĊO@jo%ޓ{obe\Ukydҽw ou[g~0l録Z^>y$w"rȣ=A'A+ kCB6.GtΟ&O Wi{WАcӘ$ j9E;-_&y {c|Uk}*A.[kϗ [ڰ-xOQ<0m&|HP>4kqŽh+i=Iy[9 m9枽6]UH }}*rR4HҦc c{RRzUJx>X=MGt :N ZQ5@AFҊſ6k?jSgH8 ׋XG/1MiԕQEQEs>,??ξdeտ*|!+3V[Ұ«t4QEQEQEQEQEQEQEQEQEQE*OɧRqM4MTG'уF&*OɣʓyhcqG'I<4`ѱɣʓyho|0hoI<4yR7M4l7hdo|s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fO?٣qw?_ꏷ]٣cShh]7h!s}7>s=u}?5?\fƏy>w?3fjkU\I$䚤X$I9$4rzIIEQEQEQEQEQEQEQEQEQEmS>s׸~6??*wyC^?VQEQE#TXZQ֐5.%'Z(cY7yal GnQ] ѭp8gLQA5B8GhHӌc>Emi@'8MR#tE4JC o^''Zd/Nh1:ѝ`dQY['* kQLi"2#H3*]4`#':\ir[l5HG|èAdtY-$SU*w $u~&j+}=T37t8qCңkIUA+E| 5F5}i< i -?y\VfkR((+g|u'c#.^WSY^[Q(((((((((((((((ҏش-.mߔz{ף^C?s1,9{ԛG 2O/gOz2p0=+Xhp8V77R'Vb-ds>[Jjk[IܥM+^tx{W->}ޛy!<_o6JQ5hh854ORD%YOb;Vop9b$u,oUi[hST7Vyo$&dǸ}=(G':h%& A**IQ m zZhv?m{ ~OΝ8⬵5ک=iV4=Jt = s埅5˸ǧJܫJD`҄']IC%= ash:FIl7[Pw?gPKH:{6}g5#/%V ~UR{l#8GUTdpP[Dp!w=w+IXlioѷ<U I$*]@*uPpl' Wʵ>!W5oK巡[:F Pm1 0k"ᠻX&^"#4ݤ}Ar$27U GPwԋo+[PgOASiq%i 5L$pK3ڞHмƄlp E2\NsTu&{ۨ#in%`' 2ph'T%/#*։o|c|A!跛`(s ]:. j|~% 藻l/ê?u,Sg\i7KQk!UGvԦNHezSBB4rC:p:{9|)?jH0GC TW6[I6il/$k J^M;M/IZu2r1P[([7{I&nZm֟ykyKi"<9ǭ TKiVM0V8?JKUxU4ln5c'P?cБvw6n !cz5d=F{W# Js*GQJsm=HqRTU$K;86r]9&ip8E'(=)$ńHUK@:QL(((((((((((( ZCFgX^.(߫OvzjӢ((CJJ:C?Dx CǒNҥ*S+At5 _ã-[ ŏZEnZBYF?Yć?EbktvÃZVD>Vޖo`p:EVЫz[lJï ֨EQEQEQEQEQEQEQEQEQEV'Q{%e$#"-;BRrj6NXr 8&FsZo\) )$1-/Q.QG=jK/Ϫ!u -JtR7)J : "KoAr2cS#klgٛwp`x95cd:61Y%N#if[fHKٛfXt95{gwsk6pdy tO w}ηd/m +ǵf8P *Ζ3[},]p cW2:S+6(hIM~g1+-M,us_#qu5 V<Hn >1_ RAHTZvRxhQJq>߈0|D׌S% # :sCgyi'oHcXM$Y=kK4]'&k:wi$wؒ޽&Q:~} G%*[_:/}tSiT 1J,;K-&os&U4-o#)*{=v Es FaWg=]!IP{Vs\}C1?DY%xUh?lUqW</UQ<2 ]=$\J\*},kbTWʷV~Ow+Ks+#5zs-rZF'L,N2kyn$2O#cjZTo#үh^ њu s t@OaOddH\QwSxP=4-YxJ@*H"0E~q<=ƹașjϏ >.I[VX|sac?ߪ~8OY$x@ ~I[B[#ΟOL:)'z$n wu๢ j.߀u+ȓ+C̍\~tqVL \(eγe +_1eXGe{oDݻߑ)$]TOaܹ#?Չ\ 1k*IO8gXA_kI3Dзjӟ(*IGP'ڢ 7S4 V$(5N; 8bN"A=GgfncʑG fpyީ"IUOZ~WmTпߓE=>[^ MQG|?k'~I$XS?:̮~T+$CŮ;8'W?_t'6IZ5rku:۬ +AmSJ.㴎;XDb uL [ꮿBya*`פRy1RXGN TǾk] u&.9#>k)bAQwCq r#HH`}<:3"HW뵔 >%pHBo+Ѿ-ω±.C:WGC0qr11K'̥H 94u;0]e(˽*FE0\1*A#ePty+jTD?)-,}u?Vxqw&J=YGs\eyy8=뙯Daܖ=UU oݢdTkTQ4h!P./ 3=CV&9%sv9.EhT5W -*JM+/ M+xN,3.rƷ>]\?2vt!9iSbXnfX6TnYa]up鋃!>crz+wduf"72Ng-+Iw<_4[Yy'&?ᩤ62Ťi9cj>( 9?hT>%~ $G2JXtԎwvL|*+FudB{ʸhRxoZC1(*/MeH5ض\Z)S+:F((((((((((()sk?euax<~i? N((} 9>GC?Dx 257JQjԻֽ3Jes_] r~ U/@9v$6Z<0|x?s*l3EU֭hO#5n98GU:EE4EbU $HG"E> /LQ]o>*k*&=v|m/}}H*qh`$2\[8#AE7)A_>31ڪh4$LwYvBh/NqQ[T쮮a ={yސ f+m~$7pmaGf}xWHLt' Ɗſ6k?j:C/FWen1oAo5Zu%AEQEQ\ϋ??kt_o Ǭտ:=jQEQEQEQEQEQEQEQEQEQEtO!k5b&?qݿ `Z\KisŻ6 ;\{>[^Y\A 7SipA5o44,VH2]?54j;1 Mw۪fiP H>5%EzKNvcj/&"ռnq#6V7/ҲY|p3n^#K#j[M1h[b1ңaQE)ҽZGi$?| VV?ެf9 )xX<}Z<0^^83JCWuj^Th$hVy<٤bɾs<`#HGI8ik$s՘kI4wRA Dۭvtb4X2#ޖL+gWAlv1ӗMb!_k-Mt.e;CM _8b;+3_r_Nڌ վ+w:jk# fi-Pjhj8湴:ֺ/ _Jt럴%qӗIGLGv=nԎWvZm旫ݜ2dlA>0|J(a b+K|*i|I Yyw" Q[_]U&et$q?pqߚ}ƚ/( r&mn4wѥXwZGO#n#{u/]JҼ3i7]L|ϜœpsjOL7;2y[p]={ k ,&|LS?O|.ӵ,h9 |`?ҿQV{{S#=d2cq_SڡJ3~w/ev#hjj1ֹ'zuJ uTi?$?qDniɊ\yl؏W|vĒ#馻 |=[]Oړ/QlH+׷ O?PF{r)mZm>CsDa3HGd nS$8AYË_O5?!MT _oQOYąIJچoGh,P%Y08RH@dgesivY DBŃke%-:CǵaY$ kZ\w0>[l2;%zR]6D :Ecxrj:ͼ@"k>5KŸo:A|O)gًR[^w}rkjmgI>"F e h>>[O/`UvkN]SM:dܠbqGLߍZT0 oO_0A'-R=E/m= T^O4<B>uz uOjš#_I(>c}jo]*?ct- \piМ8|.&R ُRx!KLt'5/”g}RI)bU-=&mz~h"~ߧJzOV2ATwAKh E9(>4qD^mio-6:ƀs$QieHUU7㹃O_0[{ʽxfECͮ,;ycTT덦$YHH![vǟzEX4v{lf7dt'Z<_ X>wcx#f1NjNJV-OFnt'+?ΠrQEQEQEQEQEQEQEQEQEQEQEO^(۬טЫ {I\O_PW-ZtQEQEi)GQ= }DMa|uJ%m[eaw5fw+9+At5FE%yS "ثTgT^c}?տթ* ((|Y0|Xˢ׫UC=g|Vf?aׅVTh((((((((( Vb<1>p$,EPT`cJ4;⸸K2 d]T uR+NG9kKAa;JI0z@*iR޺MOmTt42.iIb`Sˈ#=xSI> ak"ZKS'ڡK[[gc0BO9w]Fk 7|Bͪ3(<Pog2y[G_LV׉/ ~$Ջꪷ2~c^Lҳ+wR/5) ]5{G_LW=\gScvcK(O4).tM湐ʀpxzV o j1jNf*A*ٴK=[NOI\-Yi&Yf'"} a:.nuJGŷw "J4hY%/"?( mvB]'F&Z|]mj1A+J" sNmDW\l_j:v[PmTVkmrw'$jpǮ )('vj֣>{5k[s(U8>Ջ}%Z d/csHI,~BƬpc'ԚFl:V]-ۘU$$ :ceo=d`;cox[5}( 汴[B%QL>_m/?",8lw4vъ5#*IJ2GJnpxbIV Ix]P8qz[-cN𽎔dbBƺ-w&I+}s2){3(п,|?i ^ٷ 19rzkҵ>\92(B:}k4k7niU~&+wO?w&2\P0> CBYs#ea7ؚ|XhlkGb< Z~HUvOSޤA9 jY7I+/(\O`Mg[N })2UƉ{ ^U(&!{0ۛ` $MJ o v($#vjF.cy lxU/ڬѹ@7|M;zg5X%k*|):d >m_}K Qǧ|xwOPzd8*>3]G-][g ycDrm# Ѣk" "Mzuv5/)N:VTR4RWBHEsIounnuIh~p(|ϩ^WMI%ԧ(۰Ga. MrK$)<ǭ0k?Qt8EIct>'5 ZeC6]vː:r)ʠnak6`0˥gxs[CQ$.6K }ұ|⫿ j{i˹2D}U=UIcqXۣjZ].#u+]v-m54< V)H>pqW/k]aoU~eofˉy}[s ^O7fOLc&m;n-zηkej:v]2We_W_NTmXqSRVƅ[i7$`'U>~qfa\m؁gai$C-"oS3X҄DL̝ eCIM(((((((((( ZCFgX^.(߫OvzjӢ((CJycHz_x3长5j1r*$l3Jes_] YȘ 8ȪPsjA>67`8(ہji2b N94Q]\-ݪ\# $浨6K3ak)h6lPNkWm6*OqTF,_>Ҡlıޕ$o^Eevu<޵kZ|e d2̇+!+U z(5:6ǥeE$zF7( 1Q3܏J)²O :ȹ;NQa۽^u(!TYgH,teK*99Sސ 'kfIJ*i/'=sJ*aZir&B{C*&af+%HctG֚mh|]#f__ci92WmjsmWuok&J((_2~?2u>YXuUz(((((((((((((((((QEMQEQEQEQEQEQJMQIEPisERQEQANh(((((((QE.hJ((((((((((((((((qEPNh(((((((((((((((((( ZCFgX^.(߫OvzjӢ((CJ\zQ􇡯>ȉ@&Auoe\\gYs^2VZJҳ&~T@B@eO-$s=hF*O g3.@Jg[b#=:QZWsqN*{ W9,rDClȩ,Dc-Vza.7)2D9~S%R@;N85o qC &qpEzTL9l8'7Iëq5p"(#b>p+e ʸ=Aj MOnՑ6h8b̪xq5i%6c/LNdHCp6k?5' etsgʃWuok&QEQEs(I.`1j#R|E]"[0f2o Vy" qYڢ3K'±~q<% x𾿏j_[_j?/U/*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~T}xK|? ;ib*O7Gn?焿mQ(~Uec$n)ٿeRӼSɨiVUi( f|U,2YEr$+g\іW,qWG_H3ZTQEQEiS45ѻz=>+⏈Mn1\o%los"Ku42q?6}4Z5Ucx~Y_԰Ƣo3g@ju5 8UhIS~Q\ݹ~CʰZFiW6$T_*RGN)n]tՋY (n_iGcma=\ (&@3ȯ@ΐ]|P㍶$˸J9cLjy^?QHH=녹aevGZ%Sh[4pwqXoe4-%:~})1Oi'T8\,)$y “Jx#ҧ-[@JLOQȦ܌q4֍b;ϭ=`QEO6ǃsSL._Foэ_`ci;H+HG{Oo5Zu-AEQEQV-T &p/54h-A(_O G>?:|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(ZoŽ}?J?Q?:??3~gϕo#~tej g 9(Ͻ+FGsQ{>W_ŒQ6(>|+Sm?QϧG}]ߖ 2=GGV@Oҏ-dzΏO G>u~[(Eqgwln`Rp 2A9ɭn P] ѐ{zJ((G4~֐5W:Oe9V]DK*585(_lwJ9kfOJ(E)p1Nl(dS==fh~.UfV3; +ػ*x9bORT'@M;VZ!Iڸwl׊:S@Yĉ*Df7)*\2a3=*ee{( rrr gg+0C'sОSTriGqjs4b XzQIۚdvsnøzl3 R8q([#f_Ư$ WFズsxWuok&J(([z-:j{zuu:@_y~Zq*g_Pf-?ykZq*(QOOj{OJf((} 9>EZC?Dx 7[x]]įe;[\%Ġ0.{צi_ kY]d}j5j(uS&"I㎜zQE-%Qq Yr֊*ݪ w rջip9W;ui%p9W^}^;0ְ EI>`Ψ]ZD֊zWIKd j*D{V@8J†9z0ͻQޕՌ#2OJD&$t޴$rQc դMq ),YBri%xz'L~PzSOH3zO0Ҋſ6k?j Ã\Z -ma?^c}?տѩ* ((kMo]jſ?Zo@zwʫ]WTUQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE ((((4>(wXѝ*(bp4uE,$A,p$jV:M.{mw{yV@ j +[/eq Rd -o4r8&7 )(NjYiR1z Z*jhZ,gkyV@ek|w0\*b860\mP)">v::9ufQER;h#E,SHK1 dp#0U,9$2jpkUdP}2 PY^Dd0pZ)}2 Gms 9Pn tqea5jT(l O,αƀ;'6GHgFK1ԚGeE,*I$~g[uݽA"ȹ8Egym{gq y8ϦEGoq {T7#+U95=KN4f( i3أ>QE(?Lџj'sҖbZ(((((((((((((((((((((((( ?Tѿ5ݯ(^?e>}+^ Vh()7ӓu>ȉ@OtmK:aqu 8&C޽3Jes_]5][]iw\maЎC ) zTU[Ho`9TS',3ER5 q[Ly|P(iEw` Sy%J4QVeP9<( ^gXՕ qFk$́n>E\l~)x #S4ІR>z+n\}(5MCn8$r)ʼn;H].-g<մ(xrjD\Iq3J)iX1Oe_};AHr\x4ǒ dJ+_٭1 C}e]Mż@gJdֵIPQEQEW_oz}V-׻~??UZ/ҽڥZ(((((((((((((((((((((((+?xG-|?cMyjpѯ޸~!txt @O wia?7EYH\vr,zr" _\gashw2I ߗG,FZK4i\M$7;ҫxa Y1s^[5Ë KO2@G3ggku{i=0K,RɏJ,#G7ec+ڡw;ú߆gs}wmkuʤ?Eh`-溸հaMռKo^鶾L}1=%֡[DZ{Vd׈FDyu#bHݑe8 ֭?jU 8uV+參 K/^%{-> aEG#׃|4oV xUZisy#$7$cyPbԋHC=9sI^}qW٪6 s_Ix{ j{%H$+<{tڷ?L΋KetjV8ԍZhv4w֭ϫE Ff2*|c|!_ i:պPFmP%qԞ'c[X^\B%[ʼnԑv}+UO{K1"9'8P=r)o5HnGvPWo9xU}_i5դ *8`xC_-[Ӯ.as= mxQh~+ԭg{xl(Emܤ CkDm~H$#&=rSX [ukue ɂ3ƳA$)/vk3ڽG/罼b"fuc)vM1UN'u;I KAT]t|탁WMjŦiLurc|i݅̓\ۼ܉GVOj_j3Y_&OSOjiFL;n#K==ԭKK{ZVlǭv5]C<6-k6OL +^k^5ׄR[[[݈\6{dv׍|G}g$lusY-,2#ӌ-KŸ|_ h}9.,Q)=݃7y/X<[_nO6 ZMGT2M,G֗ǻq\j766CH\p:տwB kGI綵p|։ g/_eݠi^8;ٮ6XQuO$c/a$|T[BU{$$u)c@#5X4V0 w$zU;`${K'++뭭*(((((((((((((((((((((((EMQ\}E3ZҾaf((} :?>= }DO׌?]|x[H#qJzf _ʺPzTrr.ЭA;ſ6k?j@i@chO瓻|0-էM}Ex?qs njDvwAfxj|NXzy? _-vi!t}PWk/jZW V#--$`kݵk  ^E x^Ck=җ4,r>: (WxWT˯}b)㓃Ϡ|/^د'񎫥x_[4`-GsZͮ` M\`W:trC;n"Us@,;(#cUfdt: }]D`Pܐk㿆~!y'#RⶍagiQx |b׎4u%]m4cp5~ [-P:\Nb]<~97Qy蚆1&&Z[1dXpusU? zz=>6XʠgU}}CᦨIؐ '" X*u5k>Dڬ6dc@/妥=@_[Kç5>K88$ԺHud `tZmӎ-RmB_1 O}+쫁YW<[JWL1 ]Kt?JV\_6.UFNt$W~IbFv(< ci>xFLrJ[ABVG]|I{,$X@$`Oi<62HX< $*xGp9ip@Bz .J /~5<|_j$gᏅ#:լIkCD cR9,n U D*λ[OޗyTBsSn#OP:p}badbݹN1Ooy;^kyymϾ+#{b-][x{_Ekh3E+5W5O i^7еxMVrH@a>sZ%4o#a%?5i gm8a3d*$iZ 3Gj |nXizY9$1*3{υm0S='96+sWK_Gn9al0۔ 6g=imt_j^W5 ;WEba0zU!tbG3[m[q^2򮆢.XJ8 Ub(ܤ: HE]mRә_xTs\94RWOkqp­a#]( #x9G.OQ\fħrjҰec<63EQ!@0SF~VcuKn[m|ba cA}qhm ԉ!nJa*ΙnYFy3~(ͤȠ`xP$zsEepXMN)Y#pAずc]ېӮsTkx.9wqI%<ۂ[dt ʎ9oO }O4Rɲ9pWekEc1MkTQEQE}5&ȷ5b{ =SU+ݪZ(((((((((((((((((((((((z0#a*gscwm-- [x r4 qQPđ9; Q3UsG>*u6!9#uⱼnu2VIoݶrPrGghq%Lp?Z?g"Fe<|W5|7tϬQ} α>x2oh&w)vN@P}7@e[I/.̕&݄\b:}+ӝUԫx ](e*x Rƴ*XyTZv- CՒ0"- FǩTjFIDU'jUYt)[KwQJтzgZp' `> B ZArJ)mT9; X-c}HvR(TFA>Ro V5'$"3P0=*(:.[ ?3LMΖv9ߞ)glV!!'m79^3V;Iu["<?=U|OyjE1 p :ۿ?7+ħ 4ۯ;`\|W<|8~WP巖P3'r".H=I'n͑#;F~÷:pFoe^BcKC{gY9AcoFPOS >O&;C@O:3PNJƁA?AK6R$[H-b;#P`CFUP0zHӭnZ+HUXHt('3Cioj qL) [²бeEO W3ƒk#TĒʊV}*Y#Yen#J0! 5@]7*Y߅ tǝ_yZ3Z[OkiK|m\zc\)`e7 V$9#1)졗i)֖YCH*RAB+x(עD$TAT`P(€lK--s.ٺ$n^&Q,>5ic f`0i )pWpqu/-Prч@p:y%Ŵ7 P:oPf+hV+x(aQ( 8#X#z*.DcUDF)QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#T@5"nWQ>c\FLwzu^2WO*r3EX2p6zժ+$D Ui QGq[! uPKe)VO9=G-d|x9Rܨ p(uN2h۽ClUqҊ+A0L7̬2^VU,ފ wn>#xҌ"?|RӅ?6k-"T (4v"ONYchv<'IsDqYXiW)SeCKtɢLvV"y#ϓǨ|[#f_Ư21$@[yҼ??3Y5RTQEQE"޻_iՋ~߳O?Vvk֪ (((((((((((((((((((((l$1/%ƙ, ]9$A DR$&WF2Ҥ"SЎA]C! A4#N&+.o][Mqg7T‡>O2ktWI}l[(y cSжz K,Os Y(sQ d@2AZQHDD !A*IleYNAa$W@C)x#֤p4P_^ss }f"/ԞEuu = ¨QOqM$$qVv iUDWF 2=jDut 2A"W ^AޗKN4U)um>Z.[tԦH^{WlPb[ȐGRBp-[4.K,dH#.B2拫[Kon"$2<"q=1Dp[ڽ[i BҖYGUFhfUB($,ự+Y}+^ Vh()7ӓ”u!k"xa|⋥Z젎x(\|zf _ʺ DKAcXze'psj\s[@Eӧu_oJd{QEr _/[kVhw+ӕ2ug1E\+]HFkT1 08W|T]s8讏pq+E%yU|p ,Z[ iEWz)tlr8kFH21#TZ> Z;Tv<0CR.|?d#?+YeߑW-[cW~bYXBI+[B1MjԕQEQE}5&ȷ5b{ =SU+ݪZ(((((((((((((((((((((_m1~Yí_G$ns'y N]?G%5;Wļwk//f # F9cexU[xf&p(\'>#]x{>ytmm,!XOr~΍&dm7T[Dyc- Yެ .s7}*A1L3t.Q͵YHtۛKK2#i|B4C ?嶷ZLd>W]>=.&9ZǿQL,-Rj$sjm8I·. Io #lKH폖 f[0\k-++"JPYٻVsj'ZQK8D#;U02gjZZ(O#xPGޯx{ⷊ.<5 RM:;a= B1㑊_]U jeq6 gYӼS;-n"sijW,mDm}X>"uxP.t=&{R3i#;pY:K^*JtXf,d!7 U S[կ4 r{V#ø#8⡸X\s]#q<64]?º}W035ubVM}eE]>Ai2r U9G_$$V]rHFI#$~QSrqo,vѫ0aU:2A-@0]sk_E]l `lyqn%XL]/>^Zk|9Oaypc[(cgI7ݫ̢X|{k:Z\κ-)pSy/麎(_%6uyem(fl+EK%.k-ݖh!,XHDL+w5}k[V ]BݧSom" Vg<6Gz/J;D XxVtF{YvʅT#a$>$^Yÿ^9X Ƿo:[i i( MTV ĸ8}qQYj$e7ʨw= 7_:gJM+bݒX$I#7~=%d[-a %] ŜB>qs{mAFUo|-FI,#\r^)oxU[^G!29lGZ&k b;210 }*k}[T?jl#VաN6ySo$@Ou:֓={>oũ\Lk0Xc1Bjvю=W0Oe.;`#N8Uf 6Kd;;BF=sZ,Fb'+W?M~B^Դn5I$n a寣Z[U>^ZGkPFIVZ} ,-7=I- F(Xn=;|>X{$ vqsW[#w>u#%@\^m#A{EfH->sUkK,@3=6ouo:cڍ+@vyu/ :[JK`ڸ4MwמM61MĞ8ך7Y_6%HWz?~#tpzg:RF+sSX5Cʭ\w[GG{5R?3^V?p?j_k hfzuk2vޜƎp1M-sW#дجt/I<2)vmʫ1Ze[Z']}s)c(`)'#>x7ZΑehmn,`ԓ|yo9Cc'=8S<7KMtcÆC&[7Go,ಳ-GHg4۱mK $mH'zƞ a𮛧Kcmjmw=O 'V-|G)=7<=(K4їge$FadQJWo}P@>kzٷ%,v]L4xĚ+|g|Am3Ltq[iKfF}3ĺ[gcea~z I.N{W}SX׮mP$IF*x.nH8n˒U9i:^owxJ\?371ךC?:t7Z5(,H ]=Akkgڔ030&xe(V/=Vo>(xAo4HSG][H:+b#^Ҭ.tNӵ8*BV\<&,fEvkc"6Cn`/6),H>ݫѾ\h%{)KﳭŤF%H$e:xM[2D%3#= 5GVl&Ilđ!P隻\4Q\l- ܣץWq]-_((((((((((((((((((((( ?Tѿ5ݯ(^?e>}+^ Vh()7ӓR= }DO׌?|Qpm{ockP3GLҿk\WCW7 "Xm*{5j& c1*Hd([MHg)(~rĉ=ݴO&+Ew8E( Ec_o"=*ƘBŎtQ]uAZ5O ~8w cқ$ SͧFX4M?aEŋŬR'+@y ZkykGXPNޙ.}V BUfJ&[֡{x'`L^x=__{v{9,݅B ~V++P.%żԊ5YJXcW~yB12Ҵя7q{Oլİj󮤑`0EïEi}Y!T&f,WNA𖐐]rKF$iKʞ[|o]V-n$v|I@oB\!X. NΪr9= %bO.\]F"QӓH4PWĪ+SPuKD%/4x Yaxϖ:#`Îh]7G.eӣA$r[EZ4SH(Hd dʰx!M+GGY-R4y2v>  ]u+k7YF8̬cVT|-jJdE21DcԅŧZp&H`wP)5 \g&|At$u-)39.NNjVΚu剉w!Q9AͼЕo.Vwz? %wf_*H4Ք)Q?]$<ȿt8i4kōT:I>k;pu׺E.skv1ۊnt[5`Fxٌb洂k7%6YNqU#(1oqG-Rk-~u$bn čsHy*kiX{ufiW{ 6WQA FozjknU*71<ևh^k j&Rٯ{x?.*燼hF},]Ĥ̍'i>2Y `E'k-t;mQoƞ мekfIm[}R4SBުA*lj1xWT$ IVYѬux^Y9GF*}Cv&\9V} gX4v{-Ύ=o+na˖'vsީx'G s$qyfg9q-oOk)BZ1rÜF#9h*Y>'/hZZLw֩'Km'iwrOan/p-4+g[wfzA :9ϷJn:Rmlx~I;)>)>,żKBvZmton>en=>?V%23֠&:vI*[Cy*@LUF8PM}$0\BXc_88 K-G`'nqoei pC(rTx5X.^Hd 0Hߎ 7:Z͈v] L<| oFt֑F۔nWPӭo ;TtIA"OSR^|>om%aKtS4)S$cX~sme#p4[:TPw:dwҼMMfgfP%q #AoEJ@Lt b-6S%sc=*@J=>xKK}IJY]Όy,IXw xxH{u {*C ֺHajӐ(Lx-m#ϔdc f 3j:g$jmutzU]O{^<UH+BZm13b)~c#b5J!&U *O|;SGon [y2*KA|QNas4BIB:'Uܗ6 D< iZHoeK19(cxv85? [w[,qjsNj\ȯ|opђTz5 G.vy{┧R\\O?$۷(x* o'Qqh,^J׭"P8i-T RZs}VQ0"43~h^?5XZlyHU jGuk,b3_ZaWF2m~ đNw9/K5k%ɻɑ,rSd113\:۴%>Q|%Z'9,H-qW.JvMO p,S{k*j(((((((((((((((((((((EMQ\}E3ZҾaf((} 9>iWy"'W`kk<`=Ӹr.#=Cʽ3Jes_] -* =yTVo9$ُ20O֝`ŒHCTQV :M0v(|[YqҝzsE&lSj(xwk/oIAVO0Qr:|glP.Q\Vͱӎy$4QKԳpu[ۯP?Dl[H8=kCߧ򢃞թ^Mi[lB;I#=qysEXZS#ڷ?`g4W-[cWs'wnKYO+b ; U7s][ɭJ}AEQEQ_M~ɿ- X^<TUkJjj((((((((((((((((((((*hh?HAJW hY:w⾿wdDկ]Y>#EWZYl"Y,1Z'sE6^Kk-YB$o<gq ƶVH.dp|dܞ[xu(`Mq# ~<fe;w?c6ݐ/J/ӛL{җ oZ??p 6b$/a_w(si[ۋ4OP}FhoJiMP\#ZIMaCx,㸎??L{uHBFYwoj1_vz:~qv}6^oI"icLK[Mog qnVQhpܹ/6;R%$ )j%{WSo4Q ʱMl࣯b+s!&o40*HK˱qXz֞[kи mdaV,c|Y;HaOKŶ|5ݧ;)+' ueq) lr0s⨟Zp֝A>G\,*& }q'wKح ҟ'mbkĚ9-mTe)mJ%3IT/,u-(jW:<mV=1w9srگ#խՏ&_@kձ_r W϶k7+xgDmj?#ڪO~7h#V>٥hi{\dL#V<}s}M_Qo幕m*ܹ]޸5}H {팫$lȣ=3]w@еG/bԧ6I{#.6y3~!i:e鲸[ɍE˘-p6n+^Ŗwes &D%"-n5j]Ne1TL㷉u/ |.5`(ES ~*W-&qe6T8`s\G:CXO%$W{7gVeeQ4}V&]a g^F+ ]bHxo=H^2z_jnȴW2"b~\5sվ%PcPdpX6"}TΕ_SK{XGpl"zK$ڭA c# TSeّ&WT8u;}Rm"Hmܣpfpwv9]{i&Ŭ`@Zr^\η=*KE-cެj@ G!zqVuZvXj]}K{AP6UXi6wv3[4.wsY ǹldBHašfn&yL aՎy5n 3.ƿ!u~xRtKN*.,ȁF?𧋬|Is{ko ͭte5ڼ0E\[̊dj{;DUt?0ERվ)hM-/u8(/N9VypČ>Pk_Рnkq80d|t\F"M4|sʑ{U_eN_OupXetkR4_eW\h^5>oGK@lш30[ZS&m>ʬTG*ԣ7B0H>ZZћċjZfM$r%O@O Shi$OuőPeϵ,~*: iYhpqBQ}ʒ9$ j|?i+WQqW$f6CW#o_Elcx?sVtvi]mK*a\{TWx GC27һ+fQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW*hה~/i} W4QEQEiSR5apڊ ?Kg[;A"f$9򢊧IY S\6=EU%`*3~[,ʵ|i#oy"Mm޸3"٩vx͏ _sNfo nR33 vh}#ޞƛsQECglsS\QHN{Kmr_UH_mښ)OJඞ}NI&~̄CE| 50~CtdnlWMjI?y\FfkV((+7EwAtkݿg*w^R׭TQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEPzR0Ȣ $oĆ5I56WRC299vf\pG=w6\ȚtV h.)U+\ƥ|Fooai\):熎r5~:Os+FVORH?+铝6 ۡ.*(&I>ԇWi_$f@9̕1"(XIm6ZOU[WԇMyč͜$4A ~OL7yt;6- cL =E$^aLwvL\1G q}*)Ycmd} w s RPU+@y^ÚUw)5s< v[~%,nRyė72: (c}*ޛhm!;F.2}+t> ]wO~uIrG@=ΗwqyM;iʿ:x\ݧu+n,6Ff ʧV|zD<.B\`ak>*x.ᦰizWžtR yk xHc ]Iʯay<ӍƟfY~yj_g$jZVrAwfҪNGG}sLFIRd0#ڵ(!|ނ%6[K2öj;q]XIh֫!KyԘ؟#ޣ,^X#Dh=;-|'t #'MCRKIuM5l#Y{֟ jP4]j]Rٝ#~ k Kjf%,UVdt) l oY=eylGAҖ-&h $^t3v{WwZ|Ss^\:jn=~=ٵKkutT AmxSDd佖 d@8mr:9M(p~.3z.Gk멕O9% #9<I_^m\麍隭ޕW%r8V.Nq[Z+oV8NJu)bOV|OVڦc6yj&&QJ]CvuwK=@Fnm<g~ˉuk[khgi z[%Yhr}?w|sמҦ_%cilPOEu<5q?\hC #JN'nxFWuХG=jVoU''~#|:'M#J{ I-fvR Aќj|>/Oͥ0O#0 Z/ɨVhrFmTwMqm QVFV$gV5_̚w:ΜY6vQ7l5KV+R=JͶU),Y>.aIn/Rs~}T$Ui&F}1W`e mhX{zޞcFTfo:o7[_7a+ČI}uJᶱgir[ͫׯwnktV3mha7wx4JyFT IϊC"1OmRMf_Mn@gqzR\3Z)u. gN_I`0/vWAҥ0dC+N&sU%uk`EK$uG՟|=u_TXC,A*tT.^a[Hlv8OekIU|۱O \կE F-t(eo|x.~ u 7Ƌ 2,du[.t}VshDvTcRiksr+|rfKH䳒˴"Ld>յ}"+mBku{v/6yōժ;¯2ǯZ^|n u-.-VgVτFmuf̍7d鼹-T3Bm Kpl7 sGF+qlcr5 1$A&Ab M>7Kմe0̫t#֑MV:ժIGm[1Ƞ#5hwj+ڤ?QZL/gb g\O xI^xvI4ϴ,2nyp1޹ᎳaiiBa#s%p<<Z_\I55ir ;}"hFx vH/ֺu Vu .5E4(2}j0ArO 2a1_iZ̖2֛{ ޭi[\K+j1ŝZF((((((((((((((((((((7SFWv{Ljx5Y((CNOZQ֐5|X )Ǎq`4Z5U[<W֭QRxojqQZ/Ҋ* [7-K+ {f;3pIޠ?y80*7}5)Rʯ$ҊBj׈Ǚ5 -uub`@ w;Yp9-;I9&.}~A]ͨŬ#Wuok&J(([?oOֽy]y~-zAEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEf)(rT1ri0ԁ7`p2z;-}+^ Vh()7ҩw(>>ȉ@?Xq &=U7wM˟½3Jes_] A2[BFoInT*]@'jg)%}S4A[Sفb@NZ_e@H;I"f1A)E3YFsp$('ȫ+@}jy'8)6Ts}袺1 >(|m`>'AZ(:MIv!c}( U>م"8BOf;)Pup#@=]6vA\`?QTapjܖ_n>ץ,˙ ʄ.QFA\ƾHRb1p@+o٭0>$SE'ء+9U7s][ɭj((dO[vq_{K^PQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW*hה~/i} W4QEQEi_(y"'W.<-qI.0vf3Jes_] ji|^՗9#ޭQ\9uظ\qd#8 JkҩOJ)2Mgx_3Uٸ0E S#*84hC 9(Po^idlEvJTrm;/Q^]!vǮ' Ux4Q]NvQk62QEj=ŷ4Cs$(UA^QOK)Oa푚VyzE֞˧p>9mFQf}`qMGc=*?(0oOχt6tpWuj1k=y\VfkJ((+7EwAtkݿg*w^R׭T*2zE'5;[x`LHxF~m휂{cQQYH_og*lAv9#>(ѨA=2io~^4y\~QEB|uEx~G >YT19 rzEWU(QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW*hה~/i} W4QEQEiRHz_x]On5j2s2Bk4Z5U{냧iKF0ecjiyPn>Ư걅PN5lQRz̔fVӭQZE)_W;&# s(E{G{ai+%OEU%𞐶 wZLE]?A+jJ((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((7SFWv{Ljx5Y((CJ}~!k"xa|hf4,Iu!q-{2צi_ k^>ghQG>2u*٣4faQܶKcPEnq`!%zR.ɝA$pM!;ǽVoi2&Us@⹭>5Uɫ th?a(P?+5_S7Ls袊-䷷X [qaE\F!=ISd8hyV& }x_alEdi:\גb;g]˹QEZJv[Iv;@AL0y~4²:zE| 5F5}ᝣzHA$X`b*&Z(([?oOֽy]y~-zAEV)*#i[H` J@ET~'=OCy-:g[U!aʊ(5JIyDǸc'} (OEzcIlHY=84QE1Sɧyoi"7˖BTQ袊UM݅r;H[i><QEi]jԼ’m"EV 1 ,CaC6(_g{(,]#ӸXHRI(OwF@rJHF!qES5_Yٵ՛ύΑ>W|$#QVnA4Z}ʴYѠv s`Eēo6{NEUkid)Tgry$t`wQP[x{.$ wQ"32cۜQE wf/.; QW.(?xzQA3̰eFK c袊ʽFi$,:p0@Bہa:Eėa=>Dgp; uEU4eOn"x'u8*׌5qa5)DF92X3q=*~& J{X(1I(d=z6UFE% EUCX2wF;QEF$w0twsddc("&;9B0lsQEIgyl[(. כ^G>\)PNLt*又Z6Ւr#ib(u)p0Xs2Q\aζͧA2ۯDwmQZkVN>5̎$/ cQTb5,>É#"r9{J(wb%E3}d$8FGsEV!ӧkYQ<ᱼzQEjXƭ|4O=qEWbʲQ&, =x)j~u Ƙ"[}yQ]5TXD19G\ @+zqsn7L}AW*hה~/iOJ׃U((G42)@}C_x|<+㟉+x5w0.zf _ʺѭw"癎@PkU;TNw8OZ(APb,\D*HQ[Q*1Uy(;G'(Ϲ[x2K1a0Gf-DӮcg)ƻ/V7B"O}ŮD Z(eYiVtaҸI$8:cQS%Ӓ5/=)#EC-j}0zûgҳTY%,3NHu2hMTGy;J֡L{zF8Z}NUf1CA]#f_Ư|&-1l?஺b!U7q]ɭZ((dO[vq_{K^PQEm6)E"0QҊ(mc,S[ kg6$ #&(6dYLKv(m>ɷ`tc'ފ(ma5ä6%$O(khMoQ@SET-9OWNHފ(n-%ż2CH*Ҋ(iDbKE`0ؐ(lZ$mRzcz( rwkf%F8QE-NZ4|09QEI%%ô`G>QE768;o9>QE5ф`;A9 q4QE+Ne/glR ~r:Ɗ(:u9wϔOSӯQNK+ThYmmbaSҊ("(Kb2,Q8EV~ZR[YĎ$kň>&(icfKKeq0A;E$[m"@ƁrNQED4 E]fJtET,smsb3ES?GpI'K<Ҋ(XYuv_ǔlt<;k%ĮBb3G#+QE1dF3=MQL%̓ 6.s{sESI-y0[iힸ)>ktyAXH@(`n[;`ALK#8QN2E Xh{QEvqXA$@Oz(v*4b(XdQWO3uX3%Oz(KI|-nNtݑ=袊kNۚٛLKۧnݽ(Vo76v`~~r:'ER$'9>Rj(kxZP#(k+R6~:t*Im-uiᑕv gQM6w(קZ(=qo fD ǧ4QE3fYK1E泵i<Ƶ/QE8qsU(`!1}$B8;QE4M'rzQEfo-6ۏ%q9NQEgxr Qwc!QO@n=3EVl6#n4QEI;] ycOsESMPب4:ES[X 0v$7^q߽QR=ECP1=8)cfm-1.ӡ(2;Kt(J6꣎QHj[K`2Kt=;v)9m6s O$=h|V9w鎸)lX(N QBY%,픕(q:t)MT 6}*LzQE"ZG7 6Оbmq{QE5xoa"_A>yG "__-Oi_0zjEQEQHq>E(y"&^06=ι_˴5j̼cyLҿk\WBNOJKD2I;mzlx?jM1ӥsZsFpw>5 cSRvB~&qҕ,wu?кl4vEDqQMbT N>Y[q#$ǵXY7n( 4&k^7?(< I'ʬH(XF.'Z3"qWr{W! 3(ٯ%a^~UV qKvZhcScG-wp{EJoDT*<*^HB(AFDF. =hLj23EltXNzk_٭1o *4 H= msh`U7s][ɭ*((dO[vq_{K^PQEQE8Wj'3  :{f(GԖ7:id,¼r(Cu#ohyG "__-Oi_0zjEQEQHqܹ5z'0Jkb35j.~?`s^2;T7 W [BD8pI%ABգR1Ii`Cup=QK1V!49h4YFT 2iv)VB!="o 8D_Ҋk0Qk.]BU$2&]y',ğ*z8w|N +EZys&~s#}} (D.̖y2iecO~x%ľJR)4QY7vc*1=ju,[vr֑-٤A'zQARL!,$3S'qϭ/lDž[vズ8z U7s][ɭJ}AEQEQ_M~ɿ- X^<TUkJjj+6XTq FUePpJ+K8Ҋ(zFkXqN}(mdb:oU.9__QRcT89aҊ(Q%ݤqڼh nzhgh (͏!|7~QEre`h6`_kla[8 J(S-+/Ҋ(M4g9?|vEUMOUOZT3G m*QE\i "Aa֊(Y#bȌNpN:ElXɖ03QEF.A* o zQRyG[ßQUbԡS!KhGwR8(/`@.oj(;qg8Id v*_>(S,aI2G8'p>(.]A# n4QEWk͢00;G>J(,͵dFo@(:6YE(fk 1}*겶vphC"ĺaxoq*$y."3F@t2 QPڔf=|1.# ETܣfhE'd{7 E{{cx^QET)֊(dDl09QE.F###ES< ,x(A.o(Bd $zENR]RdImLHUMQW7~a֊(QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW*hה~/i} W4QEQEi2>u>G/ \E|Ekh̩y*x{|_ʺ/, yOjγ:4svf&EǯJy8]!HZ{ 3zlpFxc`SQc'˜?Z:-!9=x!EkHCE`CE.iEˌvLczG9>_4o.HpgkCCHOQ\ʰHzW'hPjIEz82SQDrQ\\ޑ $80(<x$tL@G>@hxz[teA7cJ(=*6P9's/l7USzJ'[HlڜORWuok&Z(([?oOֽy]y~-z@(ķ]MYntFd8^hEuq-PbGEW9/KyuX4\I^c̋@譎QE.ịoggm@pϧJ(wXQV?arAOEThZ# &Pp"@ǭQREj 7 lArzE xrOm%`[M88uQWNI|W$6uWoYCs袊*k6_Քʵ(Ҋ(zš9-uO7jfY] OՍQN7kgP-bhb_5`k7^z~u)bKi6$I'6(X1rWMy-Ȯܲɑ]ÏnhO֫ko6o!˾ r+ g9*߇<9weOGo-68^=EUWH.uݭ[ugXqJ(]6 I+'ڊ(XD9aǡӓEUDCS$S0G#nhrxkSQ2.omt(e%tBG?(xcS]=m1Ĭ%ɵt*Ƈffi]e2I'QE&jZh๎D ؜(/a $D_|vtQEcd |6>nbESúw paqqksN#;ER_ kGH{?.a%Z\X\:QSxsTS!EWSet*=b(zKk}mbl-`~'w)4 _ۮQIO uݑ׊(7ir^Vp j;/, w^F3Z(=9l#$QGb@XX#8(+UѮm4f{!Y+d@B1'qފ(4/o> `(wqEU ^}HWW4_z>(o#ԗ6r;E,$ ѓ (9-W^\V$I.Vͻ?=4QEZwKi%Iti:j(0eAwn>QE>(((((((((((((((((((((((((((((((7SFWv{Ljx5Y((CJ}~u= }DO׌?UkT8'5jbLҿk\WAk 6Nflecj,,@Z}+^ Vh()7п}~u= }?y ȶfHwbgo={s^61`'5ى+s[bGcҭ {pGklƣ;\3E%?>j%ܚ) U'KU^}5 U'iE-^]ݤ FcLw~n_R4zcߥK%P .U>ٗ9Ҋ :_S%wgoO3FB3ڜO U7s][ɭ:((dO[vq_{K^PQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW*hה~/i} W4QEQEiSﯹO|a|?3g7c\mcu0OzvWm*߅@5/%]?\Vf<Z*0&e9vV⏀OBu,O,`X秥V!hh0n*(cO[3{ f ȂO,#QE-όM3T1[ZRw)Jo3(gBմD8;Ex+gam<ۤQf7%{QPY f[I*NUbQ]-7 ʎDBÕ(EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW*hה~/i} W4QEQEiWbE(>ȉ@G&9/} Ϡ s\LSLF:+At5V1+:.AcבV3}+gW`\,O\:Bp*Wsc<@Tts >2|I3Z-β(p~[<ļSڸ{R˂3bnvJpK8KLr)s޹^KK8UfM֑ ='x9OKj#aӜQEWԞOGlҪ)#n:QAPM}(pZ{* W-[cW^!/G+Xʼ?3Y5RTQEQE"޻_iՋ~߳O?Vvk֪֊(wJoPb2s@EWW]I;A9H^@MQV袊(((((((((((((((((((((((((((((((((((((((((((((((((((((((((+k4o? Eqk?hoj{OJ׃U((G4~uQRw"'/W&-w2c-}7oA4Z5U$ #eY<ŌI$`'$*8g!wp~l/ҋ0dp>Se?!qʿ 3Þ? U@Q[rw`}ZwKOB۶sH*f:ԷwDG3zTHbď7沴3}|TdYQsmԒ0]Vc7]M(Ew-3 N> V> Gl.u:}~p1znJ@xsU*A xR+Kv/ H؀^>dzKW.R|rԐD m(1`W/(Vw?: KsFl:~w&*vl+Z+_٭1 !QQ@<`Fpu(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( ?Tѿ5ݯ(^?e>}+^ Vh()7ҧ"5p)-Ehڏf**+qd[ {tzuǢǝ*YfFa(=iHRq*d+pcZ̊i'sm>ҥyNw3uh ?Z+_٭1 ȵ}"w1MiԕQEQE}5&ȷ5b{ =SU+ݪZ(]?ö:֩Jgf$ =0s!Yi!#8)'(z#[x|hls֊(˩A4~, CG{tE[Y#ԛLi|Ċ%W-ݞzE,y$09ĊD 7s b(7VڟĊ2 %q qETͭ/ajYU ?xqQX5GoZWshO-[ =Q]&ɾ('4#&>\ =Ɗ(uю!+ vϝrI$sȢ+'ĖKV;W3u⻿:(զP5hvDf *Às(աK$Z:%;\29H-ۜ#(W;[]D3.N4 QWmbjSM4<~a@`gh|)Ѡ[..emQEEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ^Xȩj+^QCȽS}W5^EQER?o_>uiC_x|<+$*)Rgpj\Ȑ^2򮇽yΨn߿֤W8<8TWR:M=|U[W'GsP 9(;qn=Fj '&f571:-[09ێQӚӢƉ'95]59E0~((IOIQA8fL,,Z4, 9s'-u'vP, 01[kƉYL)7_Ɗ1dkeI㚻n$(8{U .} 3U.x/a֊J]>i$sAr{Q_Foэ_^hm放pWki?y\VfkJ((+7EwAtkݿg*w^R׭TQX!֮t|ϴ@2^:TQEXhM2KYA8ݎw*+rK $-|` gq=QVu;`{4EEzRKq{n*92Ӛ(-m]ͺEG{EG5QI\gVۿQB^ڸSջݲ:(PxI=odնҊ(㸆Y8QUpHQE%QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQExoa"_A>yG "__-Oi_0zjEQEQHqΧށRy"'W~7I]QT5^gR^2򮆼^$**xksF Wg^KXZ6岸WP4Q[6YFYI5>OQEju>"3/?Hzy|NQEahӼC90#~ \8EWUC=RAMe(;(if$I=*!ԑZ)kRYfa9O"+xe%2EO%gߴ&J 4 *P٢wO }/4\?Dx*dֵ>((dO[vq_{K^PQEV> n.$MQQ6a)3"YX*#{QE'/ HTr$v*T"rWvrh[o ]km,.fRH}ӆ3* sK4[0L`@s(땸y఼ )&gݶS#F)^M:%X]]dezQU ւ4Xm Xf !Ɗ(O?gY-bMt*[PEŢKֽW1q{ 1ET6~oIHdha10 d㧽QWompp|6IkwQETY'[GUgN؃EQOޥo4m$ַ aA(1ͥKn JJJ(nIaIckk A w E>[xBwvOX8wVRO4QEtQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#TRy"'W^3ruVE%%pzf _ʺ_s$n9\\T' `+cKx}ˏjYfFMZd@A;V9}Q9yxsY(Sz*)Ehx^U^x7yPkԾgE^MA>^bI8QI:n?s6&8{K]E*7/ww 󻰮B[ IʷIH[ ʖE<@ ]ump$= Pr:QKZ+i(!eu41\pAQAM[9A8N|/ljzX8+1MiTQEQE}5&ȷ5b{ =SU+ݪZu+ҵ۫^شPB>YN;(xRH%Hf z9*ڵ\X{ll yQEP>;k@P2F(xN4F吇eʟyH袊OZ< Hr.|27Hی2zf(2xN+B&&`\P8*8|SK#@<\##ފ(zٹXݒKb"h7AG9+8xH,'FgHG9b=Bʊ(VU)GO(i&l8vPѐ!QYNԈVNx9't(źa`i-`Eq}?QS+npH; gdvɢ)^ n6̣S%Ӧ(b7-$cGĜq(nm _t,D AQEv((((((((((((((((((((((((((((((((((((((((((((((((((((((((7SFWv{Ljx5Y((CJJ?!k(]a|OFX~^=>c\>j3$oצi_ kCXIQAjV- {{f<}闉U r(գœ.ܺ`NE4`>Qo $GQ΀aq K2QQI}w-Z|(P֤倸A]7KKy ##t+L.gA>{e0n)*yQmc !/jY UsKKOiu966zt=PdF0Ն'*֊h$$'CrI;vQSzE6ftU*{UH sLh*A]#f_Ư<$+;YBO+hʼ?:ɭj((dO[vq_{K^PQE$Eiig$@(.tg}BvkyuP!H>QEK6YтFEIcM% sH#EU_ Cmof^\mVXl.}2(d\\[nZm y$<{ Eks4sK,R"c}˸c猞p1( X\1\ ə7 d`#ފ({M*Mq5O$.0hA.ni*N3`gQE6_$f3}*`4i/LgQQ^+&kKؚx 3r8#ER7{W{˖f`B3A(X[`ױ=uⳘf*ɽ (hh4}a`@WnFϽQZQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#TXZQ}iC_w|<\x㢾5Ԥ#6y71'Vܒk45UёYWC1PDAb}xZF ڲ4I͖bvnGP1uUuTaDL1ߡ*/={W {; }3ILaq]k[EyodmZ+T,zCu\dw Ev/|W5 +OU 5_ad q D+"խ օ)F@6c׭_GozгJK.TX?0'o'Qu2NҢ~psKETLH~yES̀W-[cWھƐ1Y m? U7s]ɭJ((dO[vq_{K^PEC]&718E\\ZrYeHEc:,54bs$\QEޮ,ZyG "__-Oi_0zjEQEQHqܾR5cht'8aBɌ>Rьt>Fļvr`QڊO'xA'w?]$&ӿAEٞф};W Ґ04Pk2.> .=a',:tҊb+ÜQc>q oe-SJh@s*i(;=:K883)0SОثpx&GSnX2d # NqV2P=2+i^4U_89I_`W^.[a(gw#8 -Jzʼ?3Y5RTQEQE"޻_iՋ~߳O?Vvk֪ (]ۍjV~mzf(dt&VTFYh i&e{Q^DUXeOERwY<.ʑeEMF`6xABFFs(v{mXM{}/m B =N('YbIc;pXwQN((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( ?Tѿ5ݯ(^?e>}+^ Vh()7ӓ/”Ry"'W(eX$y(ڥ'8szf _ʺVdh qY[rj匟:ˣdL]B3u4x9É qwE&JuW`lOĪU8f$.Gz$ 9P=:S4[Ș =r>UuǗS*N:ar+(Ͳq #$/j|o--_ӧyA,|rC9O"QHO, w0$R0ڧ'Qqn&k|9jj?tRկ!VQ=i]RhI >7S"9 oR)M3EC5Շ֔ܐ~\Q_Foэ_nPp,+"F27s][ɭZ((dO[vq_{K^P(u-;W_h$=ݸqlzg'x*kEiwow.)qi  U QE[Ųٯ^7/h~} γH-n\d(mо={̨7Hj đ* c}>=+2e]ALy+vIRoE[HUL! d|Î袊,8UyyܔMp$e;4QEuQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#TXQ@HzaE|SO7rr1>27Lҿk\WA}ޡNC1{;Kַ-n&y'#>Š|&wSUݴ|ذ/q,U!XT7 Y0Uȕ3[$G XuT3'?sym~[oZ>>২Wwz{ ÃR@RWSE>8,:v?`v(}F''Cv#\vqEqJ $H1{ո\)0 DMsjWT n(H5rG.8D~|`(>joHbxǛfUZՕ~brhxMڵ`H 8:GZ+٭0^mјp ']ͪ*d֭IPQEQEW_oz}V-׻~??UZ/ҽڥZ?AEV5hI|J3sEUԬWyl<Ap3EU+~s-܍!eYdݽ>QEZ:FZ{X`8ic؜E;mj9 /Ҋ(iXI POQHu+dk-ͲEP_3EQS-ݻʱ4CH=QQ˩X9[d63}9(]N[b"AzQM"ڭ蔳#j(uX=11yaڸhT4$- qΊ(WXh-#MjKrFU#QEiu 'TeU"AG֊(TQEf_k}oay?q:Mvp2$&( A$2:)hȲ!-:X \#lH)/mu=0_+Ăwӌf(O7u#Y/Ҋ(KW11=h f-epHΈ"f#+A.`H"'?(ůiR/$֊(M~)!_=!d[ʊ(V%!qynRcH0Z(8Fp{v*! #QT5^F}FG) y8(C4SGȎ.el((y4_QP6(MxUgsQL[_D$,d~QEO5Lѵ (B@~QEBu8Q$L0(,hnn+3QUomuk vVă1as( 7H>̃Ҋ(#ËRCDx3=\E5}4L5 B|qGL1!Y8R ێǥ20kr)V7xwA*N@ky89Fk.I!%E%O"{u+&sZ J >xhYA EY,xݑ.|H۟􎽺 (h5uƢܢIZ8Hmc g23=*,>l.&]"o QMMmOT~eKcys׊)åH{zJ]h[#f_Ư&<-/#Dʼ?3Y5RTQEQE"޻_iՋ~߳O?Vvk֪(eea`AEiW:VbGb$T$t\QEb]6}:ssl[-vR.1׌w*^9DMvU E۴q*~K;hYxNQIlH qES'=*.^iYQyScu(O E=e, uc#Dn:EQRxr%{8xBՄ@8O "(Ѽ5q}56Sm*mS#sERj~ծl`I`!MQT:4?kEX?i8U+].S<Լ3!AEWIEW9w/5Ed$ ( dq(o dC%@6I>a`}{ec!,H#k9 xvkA\$vx(wRc΄,G͎t+,WLҭ,QEFQEQ7o|˲ɂ\y `(OE_G]į<"S~QEvQEdNNw>xM 6Ҋ(CWW7+uj<ȮPT,@o'hdc8YZjwf68!rQE:O ;hOgm͜6Pv~%ފ(e}hd29BLfP<.'7gqQH܂+kybE'T]I' ӟJ˸pGW"b$3Ҋ@.sV-5˸ez7Z䩋vGGQN?.vjG%Z[ 726M_O.@HF("kYp8f`3toOΐMD`E ?y\VfkR((+7EwAtkݿg*w^R׭TQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#U!k?W?M2>&wqۄqzLҿk\W@85~\ O=GjieiIA"۽(;$)޵_%NʟQO3–>b6zNB~fO ▔( HFj 1E{5@s\QKT/*YEYW`N#op,?J+KO1(MmH~#QEt;L+^ج˓TRXeqNu&6鞇E5'z—Zdw"q%@{U* ]QV(@T@E:!j6ÃA""w {p@(K3#?Xum⼒Pm\HxlvrTEil1 R+A4RȪzW #Q-4{Տ\j)AgX;6Lڦf z(9u-*Ev\|GcNk8r{sA\$zſ6k?j7[ZK&JH'`bؿʼ?3Y5RQEQE"޻_iՋ~߳O?Vvk֪(еFMV Ћt-x+c~4 0Hs('gF-c;vqQEgk.+7fU|rG'ڊ(ռi9xtFݤ]\6B3}F(_i \۬2+`㩢+{Zo/$mm[ HV=2QEsO x b)q۶r@ QMOv QWgqcM퍺O46yWq (K4phOtmUiA>QEOs㖵7+qd-.qp1g N0Z(|Mzcai ڛ ۡ(̇w -~|-z{E/&c(;3+G9O0#dgH둊(/]YV 7gCp;QIiٮK/E0)_a }OQ(gdMƟQ$r|;qQE$^:85Y4[T$?)1ϵQ]Vy5"E(hfX2(Т(((((((((((((((((((((((((((((((((((((((((((((((((((((( ?Tѿ5ݯ(^?e>}+^ Vh()7ҧ_(Hz_xAu}7EܡpIs^2+7{!HSa9Uh%G[h1sޥB]DS&qE#"e=E 5l{=Oc7U;U:)k}`ܧyފsu;A ?newQ])5Kď{?Ҋi8'=y߉TǪS-%l8y$?E:tlb`͸T24QY'Qӟl syEAmb'R<cr0*2QfMbf1vJ=cXZ.0-W-[cW~|-),ப#> y\VfkVPQEQEW_oz}V-׻~??UZ/ҽڥZ0sҊ(e|>m-'ɐAqGQVbcH;YP0+3G,WV׷?j &/=ыA"1d1Tژ '(oW60J }=hz:zylmǐń >(G *q}=߄tm1XwCI,@1fB9&(@4@ Ft4QEK6vn氶{kF n^v)iS!0rLgoj(vCZ [chw>߮([7/㝿QG^?حp/C(Oh7Y[C0R }'=袊si:,ifLWeRy#QK&[(pGnП֊(G!Y.˴|ۏa{Ei:Jv Ş8`1:w*ݽIooRMdP (eHE%PXQE 4K2 eBy u QE((,B" f 2O@=袊}QEQHHPKڊ()Hx:t4QE$3G(E4rHcmkzz(Y(:ESmT&r QD3E:oD+9ETQEQEQE5$G.;[QJ쨥$(D5&We9z(ETqMR#mi>QEIES"w z(׆*hה~/i} W4QEQEiW)aJ:8Hz_62HHkS0bq+At5vՄW(@SpV sZ oʣ ~m DI])kFW>L bErsڊhXzU/Fb7tӺi-GzuhX|Oʟ0%+JN; `䜜} WMH/,o:+<kaQHx<#ŀmdTlʯ)j]"E6j`*n|)dT)OZ ?Cl pW9 ;MQY21E#0^uD6ѤHʒrk?1qE/jOx'fNvZ(ͧte<; q I (uv/)C,,CF7FzQER_c <4hчd֊(.˩L GzT},ފ(uid[k<6,pvo9|/+cÚ,w$1E,ٖhn(vi򛫟"EZͶ6@,h͏[RBw/EC8<̏Ldž#h>I,Iu%ȎB[c'A\EUoZYnbim0Fq&F0œv+[B./ ^hf ŵ(U: ׯz(Jx$PyGn߳"`qv+nKU|LLo̧ sqEV5Z5 gEBʑN #Ejomx>V>L{UfY[qP>6>J(_yUݵnKc>'W8rrQM|_/.C䱃o9tQEh]%Yz6gC“z(Z;S&ȞI1p!"=zqEV5(-̅f7 N=gh/}àZoAnagB؛w7*>,Y}a$ >(O٢+5 vgbDZ `|QEF}OWRHkvHXN< מQEP[ge{{Yx YvuR*Il7;~xTOI8hWmn\Y%}m,=HBxE6{g.\+%3.C#4QE$ <%2QEs;mDcxgr#QQWQ H6O; VƸ( @x$p7qŠ({MRaw?܅bsX*wр9+7F5;"+&  ܸbOoETZִ--iPȱ}490JePM?h] QMy-o<~QEZյxmn@w>(jɪHY[$kyfq8qw* Ǹ/0Sp"ȭeaQE_: $RۭAE2B?h+G-Pәf[yhLqoK*^UXֆ0v᱌EV=͌"a;D)mxH"(n4} WXdQY~yY'%pEm&!P1EFS:Oq1;}ar}+~Tυ{dme+p(ZY_\Oϕ!S˵QUWeq\![X7X˞~{b(cVu[ 7Yq lQEki>QA@ߟEU ?XӴxmd8L<.bn@N{t+Q;弿xVxe'Ӟ(/!E,nn$o 8f(y`t$ES畄5A }3EUUVf̖(x6Ɗ(EiKs0Bx8>῵7~7g}쵩i_0zjEQEQHq~PyZC?E?W_ MBqpܪdWi_ ktKa 2Ug)s &9փ:'# f&/kZ\0MRH`1QI݊LH'?G4^0F!+̯75Z(([?oOֽy]y~-zAERzEɤ19AQOǽQUdbRfq=m,dyQEkw_QF~QE'*Ũ,3=!(n>QLCN]ʌNXES:Ee(wy{j( j! > 1*IJq;w39cQE?'* -VYCaETFF0p(dJʬe149e#Ҋ(2J*TlGj(G(f*3y'ET_j8vK<~fvОƊ(:(\j[r2>P ֊(3Z].P=2(DNFNpQIvܷǵQOh =袊##>QErx(o&[t3Lz(CEQ؜h70zQU&!S.>8`EQR] щI o'8)ɴ0_g}~wc(2G4QEgŬC,4 WP EI$9(ާ?Z(*Q6&Bs'QVz׆*hה~/i} W4QEQEiSE!k A'w[x ڭOf3Jms_]X, 0we#|zV(a gȒݸ'*bbUU4׵KyKESym2&߅2%9ʣ'`tQH?SGW?魚/ O#`:ݱ'6kYږ@2?ʸrxTbUw2Dx]#ա)81S,Fx)=ax.7r? <{QECyaqeF$,3 UT};QE/4KQ3ilVneLqڊ(}K@oSfZ ʖ! dt(ғF&ثBj66`(/ YFS`q'֊(hڅε{wgm# @tr\??QU53*#}C,rivr?QEMGR^;!kF3w8)#G` ֢{qpp8#w+kÚUݦ,;2 9Q}(t}jSfgK<v6FP}QRYTg:ʗi-ȒH*]}=?Q H%r$ߥQXW~綖٫Ʊ΀$*q{QEv}VAIHp4d,8%E~}&>M Gzzo,Y '~4QEC=֣c$q^K*mee9tF-6ss4~R`>8\+o^]w7lR{HHe8;u+>txRKlfb=0(QhzYEvp1@;ߊEV擥jQjܱ &y1colqEU]Jծi;e!ykso?D{ϵQW]F2])Y<ĕ?:+Ru6<sE' 13Qz(dI:ynb|{(;hJa6ě@3?HQE^@}Hfh&Y7\Dos4QE;QfU{)Di%}3EU#TҵXgenV`r v+=袊T[S#^(lyx?J(|Oks{mHG9]C!׎1EW3wUb1\@iGYß4Kx'Ҋ(aj$m[̆]ЃQE 3.bn6{GQE]m'SQɥh s@dz:E4Mb[fIq"%G׿EUimܟj(^m̫袊tMz{xO%[?b>݃}EWGX\CF5ri.B=yQ\χ)͓5jmpp쥷ɜ QU{bGڦ3l@*c_\܊l7[6zw9ފ(O^hWuEّq.?9袊fGl=!\=\m QE z+\HLw$  }ݳ(F\X娖Xgg74 p-+gZViui-(Y{n3nJ=8 }cQYھϩOaü\ >v';X(Yu+oՈiU Y$އnzBGӽQUoOOrGnuy#AFj(xzs,.yr^n)32;f(FR0ʉI3uqz(Zi:=%H}"T0޾Ҋ( seluRەTvǟPŠ(K+RmFTvGԄnQҊ(M[Em(Ao\p8={Ev]SK3ko*&t2p,{?Š(X6z]ݵӨ-oFq{QEs#D~­W`(FW`?,y9n῵7~7g}쵩i_0zjEQEQHqy~~<U$}OW-]AIY.@KKmxKW6hwEPH <պkXS|P/'nMGy\J3Qkʼn2wE¬ gjiyשz;NIIg=wQẒ_Ҋ+v~U`*>#>@H\7轒1fd\d{ի5 m:SkjX`1F"aVh%Eb*}(Q%mo$}̩<衰F;QE:=uܛt7Xe.HL ~8(X},y$ zҊ(sO 0=?<QEu#mm,vPĩ{x( oKGHgEfa`)~G(U',@SpAϭQDWok%KqxrF(gM1s}9#QL]f 2^["ypqzETrH)tO#H$8ۯ*(}_O=K c(.;8R[Uٸ#ފ( !L|ĮB7n袊]Vf$<Xm g(mIXõ!Ky%w9zEzq]Geqn8{EUh$R@=hյImgVW/Ҋ(nu[X칀0b%>ERMp-*S;O8= QJڭ('V$0e\}AF2#9ב̠ݹB(CN0c)EȼA`QMykV$.߼:gQEK&n>5Bo #9QSb^\y`9QPjڨaE9'.I^d}3EUY%'Tَftp2HEz]gNo"_(|;wsyϥQP4s4Qm`@22 NAQE:!Z9JerB*% (xaY!Ep;ilFyʱQE54 $s=袊xI\$C+Ԍf(MsKp;\&$ﻏ\Ҋ(Zbͭ5dlcEVwqY k\]1\bLҿk\WCSB1U@$bV1gڱGb6DhhΊZ!X^H$(['\Qg!?% r89P96 FԎۋc6zEIEK K% 8WM*_!R2WW+J:BQ\>[0;v<: ,C Zr6v~܍ǹYq:GHPG2ѣUp,vI&gQڢ:MU qSO*$kc ?w|(5L(Sri9VC2L*qu@Ǩ&`NJ}?5'䥔+=1UjԕQEQE}5&ȷ5b{ =SU+ݪZGQEW|rm?o5&7nQEi᤟] (J%h `QUn3s&K+q18EU[/_jZu7tYdya*`2~EVP[ÖI6ERAg9*4MF= rʖu +ZEK}7sosc!1bmR&(\nQq:]2YTcE)xVASDcɊGm;(uUVrA%F]0ETLҭlT}²Oy-кf\A*`(E/--BsPF|QV̅C[Iw&0 )Š(ΝqQ4$hwv{(y%,}*oCn0HQLW xqMÀp"׌Ί(²Ik{iqwJ^S*GNQ[ۚ(oK#JUe;pŠ(6։p`)4QEb?.mE$ Ymw/åQRHu{^Qn!-xgETNLҿk\WCV"Dw?sls^{ժE*%֢wG{dhE-u|y j;p@h%NrPX(?Jx]nSy?J)ջfD0;GZIdP4QY(A}EXk$H I]of[o)M >0\rPjUy"kmWϸ@RM*$ޓYȄI2~^F*EGph3K2Ҕ=jq*F0GsE!`:U'`M6H'֊ rj4Sqc',(]#f_Ư<*AA6p{QhG^c}ѿԩ* ((kMo]jſ?Zo@zwʫ]WTU\Y { (F8Mn'c"r)Q\ɱHϡ*9 HQEsF?߼O`~O} (nqe<Wey# 8sEUEU<] ZκmK\hV2,iorI#pJ R=:($񝒆+kx) ?v6yH+RZ}a.D#H c O:*kR WJmv>Z"w&(m:soviw=D\ƫl֊(z| l<$8AҊ(ON-n.[sc^QEW@OkԺa  =h*KX`pAGGNQEUyG "__-Oi_0zjEQEQHqy~􇡯>ȉ@ [X ^JN?5jROצi_ k{ėBeȦi1U*d_|QElށ-__NJ\`sW/[,jH,Z)q `WK[Gozl7qErZkX|z)| >;N\Sv+w{'xt'(d t0W jN3.F?s~N$SQE }>K7^j;rь+V)M1,g0C ۨN| Oh[Ik4t")F$u*~nP܉EN<͛:zmQEM6 ڤu1RE Ow<#xԘܒc\QQ Y -45H+)뢊*-|ۑ5O(mU\~QE-QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQExoa"_A>yG "__-Oi_0zjEQEQHq>E()C_x|<+GxZf]5D39צi_ k俹;$ҮqmъEt611Tk6W=j(_MPZ"V?(tL0rOGq33qkI+),f.~ QEc@Ds#*W5j軮ۃҊW6N@=<(2l?A]O|H()lҊv덪\d:W!eg5ʱFxq2ʂpձi $ =+z }8aզyHqJ3iTcP^ܯ٭aXT,} BAOCc=hfDґOnI=pzQHHIw/@'h97l >щ9?c'+Xyȼs]ɭZ((dO[vq_{K^P=(CxnkȺ?u&-RC4{Y8 IQ\އ\Akh9+䕦] Yۜ?QEYԼ5>X:&y~(]xH,ͤWw[ gOQEN$"K|;9=J(]ZhKiϰ>Ē%=袊̺VX_e 6U`3g֊('ot聱`q(|M_ifLI}QEg~2կ IhfQEU|Esk\)<领Sev^I9=8)|VfƇ0+Ǵ*_H> Ե9!}{EZc$`$(Ύ `N0|*$Lͧݫi%0!.JɓA{rh_j7m'fi[~?pw*=qnhR4;1ۢC0.3ѶuZ(=O2(gg$d9'(@]f=LKjs#Y0WWRxڲhckSH^KF 8i|l!N:Ϛ(nPVtEI#+,KW;hxKXN1-c$g3}{Ί(Xxwɓ̛bI69|sET+;c3]CfвTD01-ӜLQEz_^Z!0I&=`Fsg(&fP 1$ ヂ3EV1]0][GWC{,]`zwQEZ7ZiX͈Tz0F2zQEjh,qj-IaaY+G?B(~W{.JDgȐ;# p8ǽQYv7QTĊ099O9QEiB]#KX#KFr6U~e =z + [k} QKEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ^Xȩj+^QCȽS}W5^EQER?o'QG= }DO׌?|vn/|yȼFz?8X$$צi_ kmXLu>q)q*\g0*#EWm:QH0Ȭ "r|O[w AZ*jjIیEnIz ZQ)NyRAistJ@砢yDD㧥ZOb}3v_4e;g&Ap+k 7xKlRmNɨ(DknIR A dU./X50p7`T)p^0 7`YϩʸE<֣!xOz@r3OJ7n6i.ſ5,$KYH 0Q0͞JFp#j7L1VALa@5v# dzs#o5zه>k_ h0+ ׏¼?n?:˭z((dO[vq_{K^PuQYih1[%rv&׏ETs$#| e| (iB4Ainz(a[{EOgdy'!2>(ZC$NŒ%$ .=;QEn[[yDbX"qPvvҊ(wV=Jn7+*9?tg*K m  lc?Z(,EI!=qEU["n-Jg.@`XT L QEf[ 9Km rZ0sQEV4;Nv*+-T`Feh'zE1o䗏`Ȣ(X""]FTzQEϰREX<O,aQEUYs8203F(MafP֐) 1֊(NZ"̻GOE>QEM(܀@TV8gsEr_^ij;e`*kC7sEAf`^{0$袪k@Fur:j-b'U; _zӖuoOυrz8O8+hʼ?3Y5RTQEQE"޻_iՋ~߳O?Vvk֪+gEWXkIt15ٮ% YJyp9ETwC[n#iTMj`c9sEU}C7/tKKb 1N1Ҋ(jV3jY 1L ۃEV5):Vihm0 ;([xIwwз Hhg{]YIua5h+1nQEoxN\oDI*}"2t6Eko&uwr-- 11\shuxh.P"ՙ"]nJ1QV#ԼPmDE tҬ?pQ(L+(jRZ%d-&~(nqxJ[4{Ob;.zE`~&ė yRKk|qN;ך(m$ZK.4EL`p;Inhgɨ<%Y7 *Y}؂z(k+?uqw׍Pg 8R$~ފ((F $6 †/.epTw6H 9EW?459bPeKn 89*ȓvEiٵk 1gq("$GkH0CQE=_YAƭqp|:ӟZ(<9wM5Ar$$U]KffOU((((((((((((((((((((((((((((((((((((((((((((((((((((7SFWv{Ljx5Y((CJy~}iC_x|<+㿈ZV^,! \~c\Uf ~uW-*kfr圞Xl`GTV֛oSw5MMҺ#[k0$~Y/^TQYC`VKF0Uk0:S^8Q\ޥ,DgӭZwMM1kc_Lx D|B~ctv!jl3T:$fRrLq֞N4^]f?NR NrG|QyL6 q G>J gǨ8$H*xѕ9UK"; { ,dos :;3(oC)E>U-N;Rfڋcdvi~|Fa?eʼ??3YURQEQE"޻_iՋ~߳O?Vvk֪+&]5;\2{ۯJ(ij:lHfM {EkpONz(MßxQPMyE,*YQ#Ü(%Rd8I;hqE\ppv <G^=袊q%uUwhOQT=:q DZO_QWESR])k|w=>QE?pݷ#v3(CC.u`mI]6r`ÜEsp;NzE-NQEI(X@ʊ(uy4fHD6\Eoz˂p9}(m啲Z(,}*6\E( QnOlEt6IAEP9)"*ni.3*{64IX<sETܸ3QE.FqLEɷf2m/sES8 ELjP^M;&Hn6$g=r;E`ד+*P/2EQV/?0dEQc4QE\7Ҋ(#8Ϧy(ܸ'rpy(ʍ_QL] @V#'4QE<IG\QEQT=j-NlؤIϫ袊22z h2pA('3)gcES ppcbvE)e(''QFF@=hlBPIéiאXr, ԎQVqEQvp:>QENh\r7H"(ܻwn]r1ETw,#e,U~`(tRo7`c.dgQN$ EUM7PPw$əq S*e$IERoO?(KZC=bS,`U@9"(QERདྷ#ܟd U<0*!@I(֞E8f`61&(ƭ .+AybC <Ҋ(4B=J)^8n!1HbtB`= QE6Sܭf K.AL( 2(qEUK=B+dWImQnyb(nnD*XFҨ PˁQM"ma C4QEG01@Ft &eX}A*=WX\yl@iR"N۟QD:Ŝd]V*QEٝ+A| ĩg@$ ފ($2’䈰 ׆*hה~/iջOJ׃U((G4#ҊC?Dx ƚ{M}clr 3Jes_] 26*DFG 'CV54ؑmfqPgEj㰌;ݹ4Q!}袳u;ķ cʏz %+ z*<qEi[؀;eЎg)'j) g8 ^|Z?HGHQHΪ $q\;_kL𦹈J"x9Fj*rw kM33ٙI`Rtp7{OI{'LG1(3(cSO|C60!)'KEyh٣$1~PzRGw/ (UzA'?(E| 5F5}SCz]ŨŴ#o5Z%AEQEQ_M~ɿ- X^<TUkJjji8+[A$>\c=(|zN4Ewg"<'PNWv=ӵQP\vW8% 6LsLu+,Biη9b>ݨ#?%a=Zl1DZv>QEjx_GkѮ4bn-J?QXrgX cIlq;9QZI^o㼶ύ-!/ hv|EUT5AqH֖J 20'o<くz(cn"[Ar}!ox ׵QW|3yq~MڽcJ,APc>hH|;ӝ豴.[e1'nX 0|E[wW"Y"bpaw, s4QE\<55-Arʥs$Ȫ6=qEU&ijͣH!`y=q(}*+PfXf궪I\dg#Z(:i$VXՌ䆒9;rER.o[{(y6Y\Q䁞QE\k %P3ЕCpAE`iWE1V~ڏ98)o5[k}?;:`$QEsZ&qh]iB YUg1ߞآ+nGZhFc7 b(ۏ oهԑ6q(`wQE`j\LN{[tрA)k[X`ve$M'٢*/MeӬ`$ ]:qEc>aq=|IH\:I'֊(u޷$E4v >RBqۑ|ފ(D$Ӭm9-pYWG=lQE/)+)cq2#57{QEKĎ(ks q[[&w,#>QM Qxek"݉?x#6"]l{uQK.Ytֹӭ]G%SHFH 8Ƿ$ET5+/GZ\BDtěV؂|=9QEToWϷ-#xd2!?Ҽй郟j(M6Mo!$DgЙh%prQOR%[vV,01?QTnMJygQhY kC"#<"(~Үcdҁ3/y'MQ\~-V+KX$Rb>S (<[Mg%ďh!z(?_:TERq(zM9!5x'>b$n*g, 2֭.pbz.ӂ89ǭQIamR=9mg6Ἠ)BM#;xҊ(HmQ`\+ !䍉?%yH*~ %o*}5Un$z(%}`q,.mt 4QE_ާp$ ^?J(MG5{yLIqdbX&hNpq|ݸZ(F>!x!EӼ˕!Th|;2ꑹDh`F9*;o2mr^4-(C8_ddQUSRX-㱲fl<3axN*k3^]O۴M ! ٙAUe$7qQRZSMed-%WeHxcLhRF4QE]/@mEhI%h*~lH##QEgBҧ0vf,L\rA8<(:EնO4H#% DZ(Ko XA:ŨM'os$}(ڣ\\ 8${Ur#h״k( EFcPyeWi`s:sEVl~q-Vud˧WA;(|9wegR{U\ ѕpq}QE|izxkBHgyw0Q;QEx_P{oo--KO!tEWI0C WV@$/q`xm9QYom+##!7!pcyϥQR]Z5 :IyG "__-iZ}W5^EQER?oOQJ 5("U S~K}q84QE2/iOqL̒@_-VrH(vWV\CsCe=1ET'[ӄlhTqqA1(oЙ7.#TgeT66hbIvtH-6ppqET:Ȗ0R 4QEe$f&MyD{<(>%̐5BX՘!X)Ǯ QEV\3*<򦕤_lb" zY@-^202<2H c- `uERLy,<;{QSc#{̒T0BJo\ (QwKYĎ˂k}Ҋ(tQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#T)C_w;.?"49cتsƸYE0z+AtUSb͗L\4TFrEl\y݉ڣ{d$Z(~idT+^AGWQkof95fO+\jV~~ 3ASŽÎ}Bfyf*܉mnQLv3WCR/xaE>SGBtz`VdaOZ5ŤGhwkQy|go>Ͼ4p1FlR\ 60 w9OAR u/{ Em58$ڷ-l=I5Nfၓ N`c zж#gh`@ B3Ӓ,fſ6k?jC,}WkmŴ#9^c}?տө* ((kMo]jſ?Zo@zwʫ]WTU=j(SZ8wQEXQ W=kK(C2q֊( ǟ6Lg1A8?QLO&v%DIrsQIj-rJR '~~b(6s^} I,Q,]{8h奲RgWe@VGP(9_n(<XY5-11yhwu $?fm>RfQ@sҊ(zN,Ziɷy@Bdc (tZ! 6]dOo~h{xQMݰuYL9IXۃ(xvmMԘ\Y$up(\GZ()t&Yn˺ HN 򟙇~QEWo \@̗rc>*{? h-gs G<>XcVUEU3EkRnR+A#FaC=EVQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQExoa"_A>yG "__-Oi_0zjEQEQHq}~>*:l"K3,uUG\Y5)_z^ __-tYi6%oP/1c[R WVNNU[ {1zȈqzQEOz һ ֖h-R;VmhG4o"`MdK`K)qDK_>"[f= +ǟ#kcQQK dzـ2)ֹ۟YIBBG?DbI w`o71"7DI֬GƁQBo4odFH :J`Q,4, zUK"%H5! V9A84[Rp gɩɸ)JN0F4f"^7g'GA:Q_xFoэ_zxDz!ズF"AhU7s][ɭjuAEQEQ_M~ɿ- X^<TUkJjjQ<Q\^Qfnk-UPdEAV-.H흓 33w@rGQPW )LmBhEFxQD?K[ͅ[#(uy#h-2 GLH2ت'=9Ȣ*i|`QE'%"KIJ&>}_ʊ(x˼-IBґϨGQEG ʹzV7sY#x<-t_.7ʷgi+w&b@xfW%&[88$O7<EhƂ4 WF]-KX12g8 R;˿)| 3</pTM*H9Yis^ubc%ۥE#G94SX I|wnMjGicdHqrFyNủ- 5.08`Z-)v18[#f_Ư+#pw6|Wuok&*J(([?oOֽy]y~-zAEV-4-#}B&syt)hX/IdL^k9ssˊ(ÚTڙ%3Z3Mў[@8}QZVmQ VFʢjn?((?tIck1v<GQS\x[Gujm2n=r:ExSG2[9x{g duNrIsڊ(:niP4d@yG "__-Oi_0zjEQEQHq}~uiC_w|9 6b 50œLq:3%P9ץ? k'&}BTKf=5m MSG x1ZdSp8Z7 F`qcm>Gȿ;䖉r>^h7*pEZyet h q]HqjYcH$}icZ/|p솺8?F)[5#\ f霮}:E;mRj+h$HG)A8UkF1Qn`m 2CRsV׾,V(HHS*?,V`Ե\ƛVUvDژ@HFd!i3|ⳟkD7fknǽ!?>Wq]UlTQEQE}5&ȷ5b{ =SU+ݪZ@,O9+<^᷵v;QEgmBMe5Hc0!CH'QEiS^UԮh(] 'u8>QEs~ m@Qg%mi6~s>ڊ(-FYcDO/zE^?]iI7v^4!~@ I=)\^ژ 0#Hw#QPx"t[ o%c7)#.8l= +[Fפ֥xQan-\3($QY,YKXwhpL ,Xcߊ(4Yx~+y V Dś͐;EV{KQ*EhbzQTpYE:MptΟ3%(HnGQV)mewa'B#Cu#86=_cE"` 29(u-e;RG 6`FH\QEQ;3NyWce4l{EjKH,E6w'B1(& p^Yd'#|,L>Q(H5Ύ%++! A$-9( V"^J8&'@_~hm{5e3١H*,NF3+AA4^H$UFlq|zEւ}?̒Dw2Ԍ3EWU[BaYAd܋G'(ڭW?e+lϚNzg*X,tdddTTO.7sxEVbڕ%ceaQ _7nQYM>*)#+yQQ.[fáe8۝rs= *-SZ7dt+ؼ7p1Ҋ(59X#O;XMHnuh^jZ?OD Tfe*rN~9QP'5+/K3$rU]AÿEk\Yrܩ g8QE6WqiΉfX%s獠}vhδM)-6A0a1ױEWGNP/ẖGh! V$8yQEci_6VBmBҍȬ:I$hEw}{ked@~9S#hMamǩK . lN1EU_Mp+<&ޖbqs}zj(&FUMP]ƹ$nq=}D=ԓ$O[b 8Nrw =(c{4!Ŵ)I>nyj(ݍVėrȟ, # yzf(^]_XE{lGt A+dd`QEQfj1ڼ:[eIz Q[~.uHM eH\#lUoQE; I4eQݘDba  QEE//K;;2OrD0+$gQ>&KxQɶ{Y2XH[?w#ӡET-kRMk$#,%ǖ9鑜ڊ(-r'obUcRY7FĎ=QYx6Y+YrjEx邧(r^wqow-1|žI'8yG "__-Oi_0zjEQEQHq>E(Hz?/W~1A2K35ހzczצi_ K`Z{#v}@A=ZF3דެhJ-#+<2y%჏E)ě!X正NN3E 1=TRqL*БԤؕbǂiTQH7Vy2&6㯩d*@kCfO/aEO,ok4 jͅL:D C\X\'?(^yWXު>敦$1QO/E]\80 }E$R$ rOHy)\nc©jP}}W=qaJy}ǽ.ZiNWөV {wH"EVvfGCQ$)sK_cz>?j` hFYÁWsiŤ#Wtok*jZ(([?oOֽy]y~-z@y*eIZ1WhTJQLk {۠p#>(C,8r/ER h[$,c{G:FPJj(7-`>f &k|.pO W4QENF۷F3ER!Clc!qERQƥcThA! bpvQE4X(UX2 9FץQHm-[h5QEmn-V ֊(!Sɋa9+`\QEEuêQEFֶ͝kESNe'8]8(kq[3;QEkr0msuER}?o~^QE8[[ex?Z(eVRT##)D;B1mS6 =袊t H9y)(ݷov|ק_z(m+C QDvG4jK-EPm $HSߥQDvD$`1@=8)ZXhb%X6:gQE'DX-E-<&}$zES>Ì0qӊ(ƎΑ}UES~ҾLXc}袊v #3QL5};ߞ3ES7lU]'>(m>wk߯j(_)!d3֊(410`FCcp(q4QE/]cvq(;81PHhTDE,rT SESLI"X'`䎄EFMh5 m5UB$玹+@<‹vќzgҊ(!q Ca}GQGDX E4pC SEPB) JssETQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#rcxQ= }DO׌?kڸa~12B7_צi_ k] * dZbUӭ8ʌ\>à(O&ۤPr6vp G;ڮ[뢁ҵtRFbOU$2Ȭzqh{j)~ tSaRcp+[q*ֹmH!v>ֵ":mDZUp֦NPc*wvV6'qꥆNN޿ ?:o+mwaB#s\$2o9J:T$1 *d#1W-[cW~WF(]{CU7s][ɭZ((dO[vq_{K^PIQ^{CE Ķ2G# dɷ(^±_ܕ[yX+!m^{EJVxdBM?H-n:FA4o ]s+C?eS\]c1  |I1EWoEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ^Xȩj+^QCȽS}W5^EQER?o'_E!k"xa|ң:$qu/#\m3Jes_] yٽc6lћjӬnZsO`x袹d ж9h]Fl@z sć}mάmwvq( oT"|1ENQC`FO{ݿ@[:ByYFsqE" &B=)Ee0H"ɉ0h1'5 ɖ\;խ (HkkDa6bV̱OjUP cOǥZ5rGzPtE\zNG#Riz؂)h[ƛuޜڊy[MiqFK18tF(|]#f__lUĞ WimЏDʼ?3Y5RTQEQE"޻_iՋ~߳O?Vvk֪ONOaEVvǬZIq 2J~%NBx*r(&9(ҵ5(h;cq!9ETƧastf3 >QEY[ K'FE%ńRF/'Ԍ![' zQEKI%s򤎹#8ފ(1dug*$PzӠ(Z=RC0lQE,IcB{3EPgYK(2GQH*ѳ7@h{Ȉʮ('(i26}|Z(jZۀ4208H8)*{{䷊I[o"9PH\۱O$q=QJn 4!|EWQ[&(ҥ[FA XLQEq%B9ʜ0S}hO>{/֊(}|RTF1sEվk-#QEWuHta1S26R&(5;nfIf`p͜gۊ(\JB9PN >EWIԴ+v.YR7#v(Ď\m,QI6+ymcQE Xf8a>QE:9@LnsEU&a]m4ͤqT+( ~ph%-NCqoa(Gm'ͽwh6duM7>lQEOoZ\˦-먣2~QTQEIaE}{sn۱Fr,:3Gj(((((((((((((((((((((((((((((((((+k4o? Eqk?hoj{OJ׃U((G4)GZC?Dx .ǧ2+q5W-*k.r Nbe3ޭQ[03F6vՖ\>[ E( iڸ*@Vƞf ֨KAEV^|/h|mQW߇FCUJ*n=kwH9d5U E::FQhF?pyok w9 u^|%X`"ͅo!^YNJ0k6OIp U]2x?+jT}0azl+PT: #@~$TjJcD {gɟLIA R#sQޤ=*SJF Qާm.h|[#f_Ư$<+ -#1_^c}?տէQEQE"޻_iՋ~߳O?Vvk֪vqs(}Lմ{*tM!,9$ c'hºEޓ6>C-#=SidQEmkյ)gT!pu*9=}4QEMq5+0I/-ݘHU1VcOj(^xRh5x"᷹iY-ˁʒp3Ӛ( KO] u`p@~z(geۼ{Hk٫!rxw(чWq:Gn5x[OLRy*=;—=/#"u',(dA#QNV>{y}&XK?Փ ;QPjԮdkk`X$ٱܒO^QE_6 J1QrtsEU*_r4n8;qʊ(iԽBHNP(EȵmU{|b61ET6[FX- K/lEU({Fp-l>v֊(u Wf#S8PD` mz(m{O-=,"5ᐝ(>ot^+p08Ih{4[YVV_?sڊ(/[=pao)˫ q(lsffHѹ;Ny#j(4meDDdfC y*ܾLeOYA ˱㷯=BGa dP;dGs(n[;s3dG8#(/ J5+iyqO&  02FFN1׊(xcEnu .[B~$ qފ(/}VFd3#~XZ(\_f2]p* {ES03fGL*'g뽇^2򮆹=uPi qE5r?e'=ӟoT!F+SEPl\cW1\|0P3ҚxJ ,a.bD ݽ*hUn'RȪU,''޳o-3=jy1&ZMAu\XȪ>hJ[2} I`ZbtS*N:`PDYoqyQESOwz. mR) Ҧ آ*vlb[h߅Xظ@|26J(x~FEJ:q(74n#y"Ycb%8F0OQEO?h%K o?VU`rsEUuKYFΚ6ANӓ*QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQA$4QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#T54AV7Yl{_/SekɈ5W-*kSP֜ GSwsUٿ\͡%;LJr+&I-'l8+jz78e&SvdBzz7#\gn"ʁW@FK2 HF0J2)B}Ϩ3q$dÜE*E =Y@Hgj˄U 1E<,&RH&\}h|[#f_Ư|#X?]40Fs1Mk ((kMo]jſ?Zo@zwʫ]WTUQX7RX4۩fAv3ڊ(6 ӭ|jyLLXӗ( %-Kx'h3@펔QE_m4KeV4bO}O4QE;/ $;dE';w=袊ŗJ5[L(.Xq<%$E b:sފ(DŽhwS &ut\) (xJ{t{Ntb"HA\NJ(m|igsgwg{uӨ6@3zb(iy8[hH\wq(\:Q0BʁCa`}[QZV]N43C$( \FJ۶hhI/C! Kd1'gQZQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#T!k"h+\ Z#c_̬f F=L@RI4Z5UưXu cҭSH?r )FYPn`b)+iDUEn(oU1( 3ǭhA34O ^ [=,DRAAr9=(=8:)XN $[*rA*k,-xT/ܾjdA/#9V,: ֊U0?Ro.qjrڹ!'T2*ݘd=c\ډܲ=>Ny49jG_CU"{v:v;Nӌdt4pb[_AV8[vzݻDXFwv+ds֮+"[Ixng ܤRb+[rd҇<oO }|3$X+cxU7s][ɭ:((dO[vq_{K^PzEWZƧP[-*UCgQ['+q{8t.? QKa챴㞄 (+49bx|A 7s4QEi7$"n'F>F *w'|3%ދ$?ip|$7#' CEVEm6KCa{W,H==EQP 7V/kseofI kݢ*Dž˽Hd]KODZ(i/4#y c%f)֊(|Nq+iFlqA OlxȢ(>)O;\FAgŔ{E'"WͲo=$d(:קN{mis0 m. )k2Fd[EeK QEFoH{>H%YG`B(4j#O/zfH%>xEXxg)d܇,: m9*_!I.l,+,? |O}(>5]ٴS-]c(r'QUyq<%kivqwqQE}:Eϓ.(,2#8V+{aIr;t8(3-%n.#?cbOQV%(Ge %.w#&F:EgʗI)%F?*IPa{&y"N}sQEtk@]TmxYF,X(=(]1ce ʳp\ `=9(Y4添`P2:(luW+W2ȯ qEV}[͂!`&V<ESl;%Fx1_0gJ(fir\C,RoCJ L"`q=hݱ֞Rkx6$=?*HA' }(?dR%%30Ҋ(X,څf$ރQE⣳Ny,^!x.ƐoO1Lsx*&mMf n>(w\J2axX\ǶzgMQUQELuirgLmopq#'QE}% L2I+7KඹkS8RʲpFhGh-R~26b89<(tW[T .o@Or(GlepN[p'qڊ(GZ\F_Gr )v%R#vzg(+zIQED/(X4K~QEZlmo$X$;~n1gzENA5]Nʸ\*.#b<М(ڟm&X!s+N@QEY݂A.%]r,YG^Ih{I6nl‚E I^QEn}>-4(2q瑏Z(]M[xq pHmې3QE։]\K<唣;na)߱ERG鱩U]C)RĂ (Җ1YN;a\9p8*. kvE7ʹPxExhrp' Ɗ(Eq$K';<3 QIc} $푆*ƝCI<:dEU(((((((((((((((((((((((EMQ\}E3ZҾaf((OCJ޾!krW Ge: V6r7,.ebFkZ5Uѧ fxv[^4.ߺqϭC=m$VթZXaڢBv`Hc09 o"&N}(K;u`p<O_j(o-R1UrQ+ &Nb= Orx3EDiE#@upWUϋ1NI=*;Uㆮ*΍kֹR`֑rXOk82yMm `HnBn"z;K .' ,c 8ޢpTԾa*𸌶%Xv5e'#2OaU9QOȩk-rGf\ IiYxW-[cWھ|/セ+chʼ?3Y5RTQEQE"޻_iՋ~߳O?Vvk֪8(mBXQE-׈/;XsV$m&fǯ#QL5EıK3[Рh&r8?QEk[k_ZC$ C̡ mLaj(-֗-ԑʐm F$8?_lj(FWW1@!b$ 0EVχ!:ż\EkZHB{$sEQa\M⿰ hhQx`͹={QE޿{sbҪyTp}'*λpYn#/  R}b(Rɍv LyQEWKx".ZHq 99A9ESlW-2]5?fpǵQZt6Rʳ'!.=y8QW5o #Pd[v1UqߞQEai3خuknT(Va[w*UF{+ m4?\QEV[g[cY {Hb9R8aZ((((((((((((((((((((((((((((((((((((((((((((((+k4o? Eqk?hoj{OJ׃U((G4)GZC?Dx  r9Tm NTz>-5oJ}tDcje$u=+NHeKڥeA˖XnA&AiQT5YڞM@+4DOéTZF Zqeyo0`HPx 3HTqңkyx_ǭQ}.!zHWpݨN`axaӊcAq H|-ٔ_&1{$w 0|riyNB Qھ oO }G40F`+QсWtok&)QEQE}5&ȷ5b{ =SU+ݪZQSMX[W<@E݄QVcKU˽YyQETZӧ wtcEV QP_çyv-B0ڣ*e;0H4QE8zEQh0} QH:BO EQGNQEgkM4wl!p9a!rh/-+@QU-u2X.re|.gȢ)6Ds4c1]zc Z(mFo#2zI(lZ*\!HT;8QBmvպ.Tz`(O@MQ@E`84QEQEVӯ mEś&vʜEUA(װXOtYV8'.QV#4QEVӯ l̐>v1QE_?73|韦h*qAiqs63HJ88*X$Y#)::2(&ɸeB18%~)]A<2<TS(beQdQQ$R[s,jSqϯ(4QEO(} QUﮡ v8QEMFEQYis`ݍ(A[֌d;FN1S(AQI^Xȩj+^QCȽS}W5^EQER?oOQJxRy"'W6x|u(/9v+45U K :U^:TҠn⥻"&wmHtiN1,%YI1{Su[FP thU0'Ƒ Z)pnc1 *:"le'rOz5(a*e\#wE4w=hMiH>^ƁL7F9,dgl/l<3ZB?] X*d֝IPQEQEW_oz}V-׻~??UZ/ҽڥZT`y( [YZH qp!(]$~iso(bW^{QE~ Ƒ^ILe|4zsEUKi+ٮ͌ r#yp~S*8QEtWj0E;f $C m8+.;=rY,㿊!ۅkGd!;' 2r(XjWܶ+8+b/noiEXjh-JHi0˱vH8?_Z(=5 }JRG+@aҊ(Y_M;^%As'cվQE% ׅaM]EH6>G(M/ e-=Ip,%2m9aid}(:~*nRT`DE=0QEUӵ;ye.sȍ 7(-vsu 9omB(xggw(K&IywjH6E2Ɉj1"H+0r]&]B;y&wT;NyHQV]YE7eHKq)(s)(_k$ʸXVrsrQEij1k7Kk"krc/̑sFGz(YD η;5`e6ɓձEV=֗EEWEkpIm #6譀)觽Q\}gqi`D:mu*Ƈo\^p]-/Wvj!`!]+wJӮlu-$Ia>La QVm<˨Ys-b^1?EVjZBr|Id+Qƹ"m紗hb+x*<$.gUxkičG>QEiFS[ոQ#$LzQEsZv6WqKa|9(lz$֭efd`Ҋ({\f^2$‹.z(= Ԯa_դRC^8(MMfkY*$r۸°$ȯps;QEcki:DGtop;d~Rpzc )/,-o-䲽fDO3 X6{f([?em=W?fyEV""YmmE#wQϫ4QEAgk\^h;W]\,/EVjiŜ yaxtg|J|9WQEgQ,.|[ݗk3#>9ETzWΏF^H %y$"(W:f?5 FILO$F@' QO˨[Z߀4!6sh񝶥|Eغ*DLs`2(vk \If/C%(S EUP}_Beۼl~@Ec =㵲a<#YAg+ZP7or-.v,w3ʷoJ({Ap-^4M? ~^Xȩj+^QCȽWm>}+^ Vh()7ҧ_rzHzAt0(C} yN/%5\;g ƽ3Jms_] p`(q109RkR !"E=*aס#Ҋ\q,?w?ҫ.r .h㞵%Woݯ2j@V3= pI< '(##U]`AAu"Fk>%x?od ַ+ş"Œ}iOJrXBFW9\KNW#oQSds0F,Ϗho+ s {b!\QI`ޫ9`qL*f\avwbݶpZ=·y֎qRy+}:Ӣ Jb-f2aA).BL>,[a|I[%`̯75Z(([?oOֽy]y~-zAEUV,Iy-QTgl~s/ vwð)9EV2?3d}آ((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( ?Tѿ5ݯ(^?e>}+^ Vh()7ү_dx@#|a|'̻e`}F\$+`܊+At(۔NY `Jj:PTT\D?徭A=4wܧyaflIyj @Oc2lqaXqE5;O];Q/օ$wh]|x>*Ycuu-9B?J8ۉ<{ܯUtk|GlN.?\s—Ne&E<r$Slr> ?sO(̽֝sGاpJ؍?JR[=U:@cS2t8<2:R"UթP\BAdt*a|.oj;-NmV.ęhw%Kc'7%]?{/EKg> "frH)=9J"6Io[Q$x{9U{ (t_@kt|ӿڒ<(( o &?.E*w }9(ɪLOg̖֚D%$7<(ФByZ6 hkz{b W,aJG\tdX$$s8EFۢVV#qEW'}^-ݗVxaLgQElf\B!1"e+<(i筶 x?1{_׊(=SvdD ]8#,=EWW*qhd>3pzQEs]g ?:KyK2Ƿ,? EJ_hLn>bBcsNhNԯkZe[u9ʟEoGDb2: J: 88+ [OSYmXB]v8#4QEm v馆7bǖu\n*3EQ,浊xRDDJrYFyES/5͎y!2ǀJQE3L2åEyn"B&8ŚNq}jcDr0X袊ɷ[Ȩm>$rG9:E#kk\mǞ cwy{QE}~kKsR %n~]랇ESukJ i-ahJ0 g8QE3S/,]`gÂCn1EVQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQExoa"_A>yG "__-Oi_0zjEQEQHq>E(z3=00 zde[v7/fnc^29tcw+r!f9GК)FrsVf8Tٝy'8ƊD"|NAu[{1?RI}dYyKv?^idg];*☣s[+Hg+)>՟6BO|*ɴ$Cވ잀 )iH'ۜ*)q ,MmȤyWWsQFm3#W-[a&1]zYC -m?^c}?ѿd֭IPQEQEW_oz}V-׻~??UZ/ҽڥZ984QEdZh0Z:jp39 8,rpGQU|/mk{W7[۸m%+v:QEgDm􋧞i5 $QU1km,-X4Mڊ(4wWJ㑂ȅCQRZx^X4>7):sӡERX^.Ÿ8Hr'4QE;qlIԗNI`8qEw{,\$Z4ؽ֊(<3nbyyXBA:@b(ik rIǵQQM97ˑ@|yO.w2h|)jtwWJd`F#n1)㷻X!1&@h#QEo Z[\`gzQE-k ]]bp< 1OQN5.Ąg~q6֊(AKHenndT~<(5m)uM \Nqr;zEQ12ټ̆~,ݹvQEfZB]gGRAW1._QV`ӊK._8avLvEU)mPgQEH~]g}f )9(QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE῵7~7g}=o|UQEQE#TRy"'W^2_z!KTF[ q.F~c^2W9 A5w|wr'Vg u<"E2 .X 8/<=7xdFRU`H Y0QH+6Һ Ac5iSE9B*C^Z8>~1h[1ޕAͻ6éK-{V/ 9tU9涣9E>*?$2MG4d9RBw:Vo]C n8Ulr>pλcm-ңKs5ĥe(N5<1J/'-N]_k`)NQEu:]t뱨)x>7$ǵQU|W$\>TBj \C)F;N:QSOr7ZX*0NN(jgyf[I j?4QElF|?wc͗7pry#t'az(i ҵĈ;yGP68_E~Ē)x+Oܔ$1ܠ *6W+h53M 6:QZksKၪ-yFwr8zQY76$Z,O>C3QEK&s%2Y@Y6@x'* {_HkUMHr23psn$;:)(n5[IAʉz2UĜdA?*LjeTA}bQY1x{ #I.-Ubstj LQEj_o$\([$1Ggn;=QSO[o"P<ҽWfACQETV,ul$Lʱ0(oI4Wf qg{}(u$}χT첬JNv[䞃+nhIQEi3v$vmo;w!OZ(.A. CybᑶȒɌs3(]:sfFE$ea#GQEK2\Iկo.̩=@E5j1ޔX/wzEmZeŝ1(feF``@Xt֊(}BRKtRxpv!btO2Fy8u܄qҊi8cb!)և19n O7Ŀ~?No9_>Egj*>9thx{Ib8gzbp<|>.>>>`J\Y (4&C]Ӧ%'oZ(j girHh`f(dfExKpJ˞GQP[m6bcCG)cѴ,mbERæ wdX|hYYp:(2oOi䐳Ss9NGQE4"6q(Cp02>QE,^ CUaHqڊ(--4߱5v6X* 9|EPt2@mlHPsQMmLuV+rۦXERIro4V6cߞ9*ԖZ Y #eʀ: QEU$2ZB+UJESmt:tM]7>袊uƗaqhۖ&@T zEX'e(ccalc9 QLeӜ(sQE*j^lm; c9QE,^!h.XѕORýQLLl-1p}QEtqnkgTNH_\8)FDpD.;aG(~Ǣ bX  @QH. $BۣYTFxQWX! IA}G|*&mi"aaUz*W$N(K{G9-v4L2}1EUk --KF- W zQDz.n[ )imHɷ@ rvq)h4He&n@T'(MNGcnF E4V^Cw49,ڊ(.6iٟix`MQL6%(,-^$c`*9{g(ԕ${Pʌ@lCET7NXEP( ޔQE5ttF( nHQEH6ʶ636Y~QEMgI4v6 j4QE@4-(K$M%ݽ?Z(M:==Re*a zQEtc"1|v)ig JC*sҊ(mHitG2.LC݌ETͥX4;YfBPdSP8)Sݥְ)En?QQZuQyߧ'(>a:YV@B)H(4]29,-XHd0]Ϯ8QE=֟gwq641;,ENEx%&̦B99QR'hķ*#Ax=zEʰF#ЁQH6֏jn2irr[ET٭ζd*[h.䷺&A!*SAgQIyVgyv#>Ҋ(dl_bH4KnߌnϮ8)htΏcn7(0Ɗ(]LYcn%3QE,z6[cl30_QWc"cUF῵7~7g}fҾaf((} 91s)A= }+௉u27^?榗|Bs1k4Z5UR[\*R)QKaqֳwB ҬqzԨ'sE6Eyg0[K׌QÒvLQPB&:X~'fk 23ɐ>?)Qx~ W=ul3Ҁ0Ny3HGI6\41_nj}03sJ#5wG`}~x;byǯҫGt!HӽM0HpwTDpd?*rJ"’N9V|VV@)UbO6Tq6x*%bH=y5u띨Z(=v)Cp3yi 59^k9z+e ulE3UkTQEQE}5&ȷ5b{ =SU+ݪZ 3EW=ihR}e3 $\Ekk"rl?:(=jqEw<־d"efp:0ۅ@Z(4 NNo$b;ow(}HOQxiGrBQEa[w6Y\%Mv!6zgފ(U.lmt*usAك[(<%{Y"O2ћH0{h,uq{{7@[mYp㰹?w4QE]}OU fh $YFݧː2QEA6KB(X *EVoo.Y${#m ,lgQE'dW6.2(hpqފ(R xTDoȵ{yxbo56ě]Ot6qz(4h${coHNX xp;v4QEO(-e k[HϞshGsmÎXvX f(=B ӤH1ǃ C f(Zq4o,?i5^ X+.NჴEW,5lisLe \"YļQEhl/yv xI *9=(lƮZCw0CLmw80WӏZ(.qGu%MFՌn0yzqEQK|!i~$YsnEFtCw<,c %38C+o"3Kiį %}2>QEsl#cB`̬m㜂}s֊(Zբdtm@? $S;v <LEsW6zp̳l`r39Q[HuK;qyssm{ A亜H^H>QE`xUɸ@ѻڍLExy1hGvMF2d)8GEu[B;4M,[[;֊(M:+y,Ku;d/?zmʂ9(R7"Klkf9\pOp@EEt 66<z֊(?o'6V!O/  ]2۩=5+ntcq<֍lxq(uJ]nEm> ĎsQE( Yx.dmh܂T ΋xȐK"$Ivq3QE\Y5e2%`}и' Fc>)2sى><uSYeH$s$fZ+?ҹ1Ϛ P'?dʹ#'Ҥ]'ڢҜ@.㚒`zZXI(>&DdU+lwS*-)@矠ұbGv4,zb?v 4'c'4lp7V83C!hN9#z4E,O@_2PVs־F'7pm?ٯЏЕltv6ГԠUWez2*J(([?oOֽy]y~-zAEVUeu Mx ӯQE^سC2BF ڊ(QE>O$Be±#?)E68 (50Jqa4QEKs(yBE,;(* 9tǭQP鷐V^Zh&]Ypqr;t*+&QckY+Ai3#asJ(ʰbآ)'*ǩAb:4/^}hqފ( QFiuY2H^QE{ʊ(l3mc)#%W`QK(TQEHEQ`(8Ҋ(Ҋ(TQE7z=q\\QEZOy̶de}hs(x<{QEȟ|"B#$8_QK"d20a (%+\,qQT[F7xbrBS;IQZ(+?RӅSeX`9f1EVu()D&Xu($pF4QEW(4(G p.B( |S t*lCEUK> [Q]psҊ(F$RxR#QEWMҭd$c2J=bp=qqI#u۸2=GQS`({ʊ(EQ3ڊ(_ſϵpJh=4QEoPpj= _vxcR\Ir :R89CXBHR{Hm}iG6{'ڦQ?ԁFaH8݌pjψ  GGUlv3$mҚ"I%zdC0E8\sc]_~> 8Q '@ jM~+4F0szYnpuX/㺶kA~@7`?GQESu4Qk[eeiL惑?'j(SN5[('k֖'|RP0'n@qLEwZifM<]і0s;uQWoJ^θ/ V݃\*jqlnPqOmdžaEVfGkk9H"_$tDWvn6GN|QE?_cC5ǖ`)r]*$`c QESI{˵Rm0BLq֊(=S&X!3 ;Fh]3VҬ_]EmO13r~QEY sYOiffi,o9בEU{=7XzKܵZ@G*;mg[wX7$qI:sEU] U;tdi‚bdHqdQE5xi,`(. G!bx',EV_jrxa^OB* _L.5Akqu,]<7NQUeMetdOng 7 QE6 [L#Z]y6dbsJ QJvK/5K3okc#( K jReY2(u\t*z=WgҾ+ o5~dhQ?uȢ*Džt[=RyEye[hc 3(tRKlkt<BMq`;xÊ(útfXn3øhwt{EVum}ZEr$W C08䜞x=袊}B'Dn^E@nhc,.r8lgӵQ]dž ,$*1k6p?E#N 5A] #2 ^+LB 1~QJ71ثI j1;vV0DN?V bN8DcQT^lʊ^Z7OV4KF H^IJ#ٹ}jf s/*y&NRimƦbT-KvxMJ6˜*'<M2IB}Aa^ AL{ AlNk,zُ>k>Љcb{qx1^i}ѿeIPQEQEW_oz}V-׻~??UZ/ҽڥZ(kͧB-}ncQSjZv ֧gݤ*[ g*žin6Fĝ9(v 즴n|F6\EV2缷Pʳ' 4QE#jr}`n+#>EU{f.k9)LH< Cp@$3*eִrP7UV1(%}G"(|MES7$Ѧ\d)Bse #"8 v*9A6FxO%Lqs4QE3UYܐIɂs( g! YsP;EUX}:A KvYN9=hP/a%*7un89sEVs-FXf*-[K|x+I5]=omϓ̘q׊(~"HmUn%s&C nQEijYZI@̀QTnOY"{9==QDpkVwB8aLscn19*^[=Y6g 6Z(4C#5;n&X;=y*blgdRTd=( QT,P  d˚(1l]gYc^QEJޗ$DIfu^z(u}8[q]Az(0gs4sYcģwp@ gQS.rcI# (|KEi7$XYZ(%d#pcogJ(mmJ=HAvFp|" Ϧ:ḚqH@*F?~QER:T70\^ ȱ?w qET,'HJK \!l'qEU(³.jafd$ʜ23EP5k4 =ݪSIY3Ќ(8;RVA?J(Ӎ s<e ӵQG--_ETqjt q=4QE51%I68Z(Fh/- &Ɇ|QQkhe%biX&L)!@dQEeuK񡺅duܪ̓nҊ(Ck-ȹdG^}(*j6mdkc8sERsJ_6bD1c4QEZ[?qZ-p:E`WMn e7r;`EQx{ Im4yqH !}f(,$`5Wx P QL4kkqm*'}=QTuYi3ZKEm܊XМ}h[r٭n渒ݧ{QE\VhmLvKVMe_wMQNWӤVe|G:zE k6;!#L b8y)$p}QY#W&rq3hsuAs2D_ q(/o2ц3QEg]孁x H1l\1׊(: `6H@dx*F4V/A>^QEk[OռsH ܎!5῵7~7g}nҾaf((} *}r)T>>/E|i"xc?0\Ġ,K}zץ_ kZj'U=6C[/cO^Elݐd~jlךw ۝9${eo?;7Bm7qƜ:V|7Av^{;UU"S3QqZvΈmP`̑$qR* m\<&=%IqqpHnvZn>bsN[8%?LӔ<+\JŖS.Z$@x=!g9y+Hѣ 2Ob ӑd}| ھ hŚ>?518x xcA75Z%AEQEQ_M~ɿ- X^<TUkJjjFS0 Q\c6H]R&Kx<ٹzއ}ںWzj=\) 0ĂH@s֊(z嶡5r|FGF`co\d*< xlƠ1XOnQE27qf}Fkecg )sES|#42Cosg n*7E )4Zs#m^(vw1K:4r,_%^{(/\ë>we% I!V)cQT<-ԵIm$Q$D 3QWKۍV[Kt$8V,0z(oF@T-"ӎQEu|9y4tfp,!X!~094QEE?oe3jpGls4nz(KOEh!d7U$aH^O˥QT\IrJ1ʓ[y4yђ~^>QEUs۬f2GFj4l d}쁜 ` (XG4>AnŁ#w|QEJKϵjWH,yݍES)s 25/%!vJUEVcN=Fǰ99QT4O IO=ťj-rː}(wZא^qml+n?6xN0GQQSKzhFpr2h?nQ;*A@,zhs1X^lvV 3EU[ ]{۠r+tbKu-߭QUǃ0\Gm|ln~~QEN2yI\@Ilzآ)~{5 oI`gRG/(÷1j_>qiLDAV61EUKOKdU-"R{iTh%[iaYlB~dFq}hsZo.nmcih $j} ERE[IoV[bL!Ȕ(sœ QZZ6w*8o +ȏ,J@($/WwŰ-Vc6;pݐyQEI,҇&׋'+?sۯlE<nK[hVX̛aR1d zETGL׫4[I % 4lOq QXj a-D[_+@xVCqwk4{]ѭ HݱERM+mc-Ȗ $ 1l@$E3xYYcX%[SϘ?p83ESGMi!w>̡P[O*nn{h"h,ce y[={cQO<3{ckqj0mT:BTFQV`YsyiHH2IEU)|)wuu, $d?=BsQVƇ1ҚI,d-myh~c͟N8(JɩE"@! 2Ż99#J(Sj$`;-hRGbg\Oо\€[K($1#Ҋ(MI/7fa| 4QEGxnKHPkha5N xY#uX(sm΢^pqET5Е ;2 ^8yET0xJ=FaHpб,ѩ^zt<=ɥRʒ!RI ?Tѿ5ݯ(^?eOJ׃U((G4~= }H&X`},_>#V7mn5^٥/o8Lk\WCs/?\vO 5'pQRVRU9)^#;'IIEz(msuiB3xǥQG{wlb*ʡCS`\(QxOH0ݼ/~F6( =F(]Sh|bRϦ1 ETƑK/@dSo\}y;(6j6ċ.yu 4QETRMM3F9†$QW|Ae=tŊϿIQEf[5hul$ؾg1oapzw>QEj_kY1j/ɷ?76.0b0x9(ψ2\k8.BeGvN:EutJIkP`u)^+;gkH|8tߓ6=hg k eR" FY72(&,A$H@(W+嵊'q.ƕV14QEg>&X5{Wt 4Wd_=xn;f(&izkm xcӕ 9 QPkY&[^ فdQ&{QE 1ӧDQ]Y E.ycیQE=ш/G$ClvE=&+:,`@Q>QEAcUhv}y4QEii&6:A84QET[G[~QE:vV%Y1meM% [g\QEIg.6$.Xg4QEUZ^O-⭣N Ʉy݃(Ym s-RU?1P2 8(\gdng8ET&ސZ޽E0dk91r:QE^]}$x),D8wgrNwr;sEUQc "bjSy9j(XE+ /-Yd$cgWNOn1ES$Rܭ7ix#ƍMNң#QQ%GbIsmUP$av3QR&Q.i0_BwӌdEU֢]Jy>_ 3^y=:(XT&I.\EFY2rxShUhzo-Ԣ(k&Ðr QEh7lRY!IcQ3!Apx)[VH[ASj";̜{F(KEzӼ6w j̒eAa($dI*Ɲ+]I {nI6r?u;wssEV$cMv""(Y"SrpQE_Iou4B:.x`'#QE?l[r҈\ Hq$y*+Cqp`OԚE`bj+жO#g9*md7|Xsp{E{m\fA'HQEVV2# IxA{Eh;k#H?**݀0\b(:ĺmƎdMoQJuzQWg^y GFU[ks4QEl%ݬsG EMQ\}E3Zi_0zjEQEQHqQHz_μX|{)?ѮKPeP3Jes_Z A\&{q*@p@#$ y5nR(uPZ5ViM*c{rG.*[YhOҫZM!m&?)V m!e;xf]:Zlcsn8JRIs3ڷ!qipIVpTg0I[d=THRs5cs-\^kX8U*#2cSk 8'{UȟVd7/{ qG^Z6Obrݍr.\Yk}Ҁ#9=3KpPI4  #7oU@Z\y(ɄjV2(;?Z|f$A"$?8!ی`{elK9 UKX 7O_U9w 0ivc$jU$JNIF'CnӁlapkۓL:n|a֡3maOr !HTwt0eֵIPEQEW_oz}V-׻~??UZ/ҽڥZ)4QEez$n%>d"YrETPj  -٧%h_ i Ʊ0Ld+]ܓES$2C,.1v3'$QE?_2__('AzQV,K[[pX/I&I[p%E^E׆KRL4夌c;E 𦛖H|9Q䜦8EgRm5sra"¾ ׌{׭QIKNmc8>iޒ߹[ Ȣ*95c<4]&C77.u=0(j_N6V*F|lRF2hXEgjVY`P N1|t*R\'>ӽ$ʥAQE]Դ[MF(# YHe*= QUbWrs.?9Z(&mKIhnJ%[f;h (YB$((TN?QE;NՎٽcX{yj\a*]gGo ]sI4 A-Ğ`ޔQEI:Fm'671J84QEgiWuF((:b##EU i(VO!L 'ΈJUS@QELI3NJpϩ'QKt˻܆YpX c*Gq(G[ O-ѐӋUV"{1EUWEy(6Ȼ[<QEU_ XLKIVȊUA^QE4WMvn$v}Х9gQPxÏx[\f62KyqH)*aoY%l !}"7SFWv{Lm>}+^ Vh()7Ӑ!k_('PE|1GSU~kmC'qi#y8qۿNzYٖtVɽ̌zW5t:fYx8AUu@]El(D.n8D5).ғXuw'; .}B=^ 95 i2z֭+XΨLK03@QU/)(75.;HGZj3ׯf9#U*"7-AY},ORzbѶ>5 9Oh7N.4hZ>)%/hX)_Z&Lx^'>Q#s#(t晋Tm48!qq_#XԟMlT;՘cbUEGV猑OPb&[JWYܐ0N:R泤Rݞ9e}l&U'< ҥۘ]r ?Fd@ wӚ(1ڔhфW9ҥIjw>QP\bx0eԂox棖с$u5DnS|7e_}5xGDlc60pW[=ҼFu[(([?oOֽy]y~-zW9vv8J(ezַvU[0o3gϑӾGҊ(?WJYY%I&,`9As)t]700b˸߇^(Q⋘|EHd@`GNTR13ET"oBK{Yc[;qUx(f< 1v s02GȢ*iuknhtS{E+ /ޤVRwF"&6~#EUj3ioh%9%fbFG(=wh}G\YYZ(,d.A\{QEQEkRTAex hٞ$=袊{ˉ/_]\e=@z6wQE-uFKkHD7QZIȬ]0?QOo^Gn-mfK-R 8'(-HɐMtϗ/N;#QEkkQ^_9e )3rd(m[_hX㶽% o9 =xQW=)#0qhƣݬ %I8HI!U =4QEiQEQEQEQEQEQEQEQEQEQEW*hה~/i} W4QEQEJ޾!k?ỳf,o =}05޸f^6#ZO:eʺcE+4!˓ \RLs!~m{Q2y6@ONf'3 |yze<giGPĨ88>$.Gji-ZV_$֣7ش@Cjjeq=jߵbB$һsfǵj"Z*7r ִbܰ?*K |хbuyڧg ;>N"U?nqRX|G-~t}*+r@5uzfq#ZFuSjݨ2:dڔ(Z[$9w#9T-+ҮG|<~f ;ˬ\/$Z-+6Oʑ_ vZQ^?!$tdLPMrMD?y~FuZ%AEQEQ_M~ɿ- X^<TUkJjjJ J(MJs;J p֊(afE"Z[#aERci$K%,ݣ{QE +@b" czQER]LGX \1mMQSK鲒eܱ$NNs֊(˧YM'-ɕ;%'+Nq۷QMm3Oc)kBeq$~vQEU4M:[vX|wA}X2QVHXm:̖7z9ES#x䰴tnhTqҊ(ы%c~|(.m.f g(d@~ESFd5vc%yKԎ8QRorJy-4QEBt11 +yK#n9"(EF˝"Q袊A,&%q\cQO+϶O(=Ì|zQEȴ(L>Uy#FEZma+$BQ 9(<3BV;D0WoR1*u%ٶ$jG=*t l)"QQE*iIl_+&=(ٓ8(o -#[R?e@ >QEPt;]+LHRwx9cZ(-I k+(Pj(5 o|ߍQKf#8(t.HH0&g8#QNm2/cjA*rESiF,s匰>QEUum5HPp3;QEg{[v_)pƊ(ko G,:E ^!ahrRaSз4QEO=yW,C#`1ӃESdbY-eFSETGKBйs!o%s:E騬٪ydWscyQSCgkO  H³cH4QEZ[I:%/229*j,v ݖq#Gάn)ZmjKyvž` ET^͟ٶ[6.6:t'zE @;9;EiZtM>1|4 F0ONq(,,b--d(zt) kx-Fpv<{E5QEQEQEQEQEQEQEQEQEQExoa"_A>yG "__-Oi_0zjEQEQHq}~Hz@QcI? M5&!"ҒOu0QOֽ/K i-;ZOaHo_oq퇻˽YIy.Flg?K\&1=ꭅ0 TFo }F[&a*sڵ D"NI53bPNjv!W,pRk2FR^l=Oҩȯ^ 1Z)緵Y3ڤ'Pe`Z۬4p8c'ޯm Z*x@yB.S ս[m89weM@GmLG#\YY Cg?ҷ._c7PIk w/}.?搜YNJ_Z4ckӴ-J祸ضpr>Ԛml3 ҵә8ˋ%%st4YE TtS  bdy#/JIu*ac2)|-⳻:{ný6=BW_tok.QEQE}5&ȷ5b{ =SU+ݪZ((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( p [Zpe_nnTygOkO`L1P"<-I3*<\:͠(?ya?)Ŗʈ8# l$2 lt\iMP% c}=1kkv윜a:< ILź|""?b#œ~L)xN)$Qrbb#œ~L) &yS?Z_Z}C({ 2Nќ?Ƭ?Vn!qmVarg'9K&in+y8Ė9cCJ"]k0si_vS1\|YyO "__-Oi_0zjEQEQHq1O84!<> abDKeڼ 95kš*Puͺ#ꢼ?n?:˭j((dO[vq_{K^P`SQ\^$O/6sgYr@8#q+LS[A A4Wwj(^L-BQE-eQ4FU'.2Oo*垩=c/ }qEV~X'ӭd+ț+r!oR1ETYWʾ; sr(Ѽ[%t1 +5Ka(bV*I&1RrS ,c֊(ڗ]?M04txDwzs*NYʹ!,ߕ?(-KNcVI%LH ',QEC6-Y W ́ǩEU}OC/f#)Qс(d4QEY_鮑<ȧPބ#)1X"M2 ~1(m̊Xa`2),Koska+[]׹[s J(-p2 y#t*QEQEQEQEQEQEQEQEQX1k5 6aKm"rG(a6jVE[ hT2lU'4QElVK`2 $ex_MŠ(}6CbCF$cZ(yPQx݊(V[bLTHJ )>IWhv nVI )ǻ3E<" &>y@`&*Oq([i"M)lfSpU|=qES#נYถn#Й72EQk]6t{FXk=(EP4$o*W*qq>J(-Q9#XȅF?C4QEj\\"N[ y7@J(aInٷ)&E U9=EU{&Ia ,AYd=_ %w22Tdn(7ȋy: F(q&i{EV2,Ф220h}QEQEQEQEQEQEQEQEQEQEQEQEQEQE##Se%br:M6RV7#1’; /TdMinic J#=|ⷍ5 >tCPdvHg<g~WKЯΟ=쐲V 7t9i[vڝeW1]ݿ5 u-Ha!%%f?_AhVlCۉ4!; i> 4o8㻶i%mÒC`sZѡu-B+8!ǔd| tV*kSUOLH?pg^k)8}%Iut xUʮգ #L*i#L:Qp%@@Ҽ0\M4oZ+d_-3 g>v\Tex_ҟќtiC|W{J8~8?J+g/O>?FMŰ 1?jN#ҊSg!O,ɥ SN}> }[z:e/G wuCYQh[yz'><e3d[!wn'&xEg=ķ\#FWQP^A#" 5>(E ="].=7L$%i OOxk➥im-Ѣo 63}6K{7P>8 wV.dvXԊsNvG$ NvGXHؽLz)?xa"_A}E3Zi_0zjEQEQHqE(= }#ˋ($+/߈Wsqڌs^mϖʵ&vvXX&nbýf_ *8$R3GplH8-yv+3:UÃgVic뉕,>/`p+T.N#Z ROsW Hq3T;w>7M&B9Q֫:f/.:ݪ+ǁD@ 9+m6+h4N? 2T z:UiV`d+xą /dknH>5!8+"B_:y[j2UbH5L5J'oR)z,,J\gr*械yjylAem0GڶKK!~ x=_d nq|I(%j7C6p]95@[#+U HHP)ڝh)pH x!$L7w,ةApcAe=_0,:5fáズ81袼β^PEQEW_oz}V-׻~??UZ/ҽڥZ9p}}(ŃvqEm-@$I#휶1K *sQKl"ϴ,j\a[QVmx-HfKtP~(<=$L!F1H߰*m'F/bXrUG&(ЭbѓLY. H%R\n>gQETzl6颚H>UW.H3(͝>t숒I҄}黌pހuQJ<3b,er֒]*:s8(qL,2-12s@ϥQUY7/r\3,]xQEA[1dȐrVS(QEV© )2A,7yl}h'mhRP Y7<Ҋ(vuiK!&@w4y+?9(qy *2d}p(b4,Wj9lg<Ɗ(TQEQEQEQEQEQEQEQEQEfKZxSyLya۷:cQTZ{Yle BA0aEU Q=rMWn 2?tQE],-M:k+/o(8<A(xz[.bP3GGvu ERXFc1!"aDG1(E>$V{D*fEDET[.β#˕;1c*riVm ʌ2ETq\nlchETQZ庀,",r^PG^hl泊YnhQ|[$gw^(#՜w"xI%.[~7)ߎQE\74 ]q+c<}(FSo6.2 ~nNw<HSQNԦng G.bMQD~`n(q3=?QS Y@aK#rA sEVV6pۂ!v '8QEOEQEQEQEQEQEQEQEQEQEQEQEQEQEQM[ 2o2iM#M'` k⟅Pak_^? K֞"6_V?c()+~1y l9 UC]HbXr'E|-{y8꾖2ϓ>մ/n2dg]σ~x,lTbc,Sk+szμ^JF+;q?Gr~U5>Km*?cj+oҾuz/SxO5ֿ!^!J\eZtZ$Bi\SA~ O[O⿵7~_7g}rҾaf((} :?>u>I=:¿5(lors;qWvM}95|tPXKV-+gvQ\ZI>t'袤4F`a=3E3%GޮmZ/JpPvH( n\IFv1KbN3[/1PvVR%_t;/E=3Q(TlFxĀ;s$D sZIQNZG͚Ұpc",$Vwr\m>cPI =y+GÍ5歩\,'{Q] QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE6_o4ɿ4k4h%~B??~ {%/Zz/IZ(Фu#,??&Dnz?*!פ?Zo7o?og,-Fo)T'%qk/Ŀx"&@Ԟ Geܨdb>3KG"h4 IyVY- GצzV͠RrWKeĽ |u" r=>;|}WMVl {g^{l:$O2;tZycXYgw&29tZ{cXYgw&29M2I|ڸmi4t0>>8|82=dG-Dx0Wlm>dG-Dx0W{(5syU~A]ה[_ ȼI?ʷ#!;_ Gc_|E^1S?_>W|_b=saj"*7Aֿ?ZE}ߥ2+= kxa"_A.>y "__-\jx5Y((Jr}QiC_cxAAq0E~}|KV" 0[Pۍssd9Ye4llWUX U}^2O k"yG/U2m Lջ}i.1#>I'>ޅVmzVemKcJZBFIv+O/bt2#`FVlk1f=ޭ? H lEswY6eS\BFYt6p繫VjZmLpS/<Ȟ(vKe &R覧Q}Ov<w/fL˴ckzz0]ɓ|Ԇ/􆔁Lu>1v +ʫ:+8X>+RÂg w .VS`^\h<*ond Q霆*_ZձTM/P9/DDO|p:U9"NQ~隽 8_$Yq p+VYjMI&9)UVGUjKHąbAH2:6f2+-p>j N]{|5s7?3_vⵒG4k0n{ ā+!i}]r\ʓ bT/:RS!o`|1e<;8LC | SWſ45o íU囎|LYƯ]2fg@q2@AUm-o9Sn%!B Tۊ-Bַl*˷8$mxo# s폧#JXzz3?ږy7J3q}_ë  t)J|ZAnϜݜp{b[k⽸xD6K>s]7ƞ> ,2%–WOi۬^l5o>e$4_L#5Z!n-m xЋhc a~7ůAi#ϑk HHi|UgV?񆙠v;\DDHTw5\nޜ]I~>hss\Zv+ߋP_k⿏\?-szWI}2++A?Xs_+k4o? Iqk̿hojo|UQEQE#S:QփҾTO 0,E|%!?|M3.V;}5[?^8o5 <=B.GA5B6!<40}qS5'9>cWod[<b@=94>^;LzJlO2IV/{8 /I ^܅Q;`}+W&+2F~FLhX}mۤVP@$U[D@ ׎awlW"aQ>5UISѱV^Z6ntbF#k['9 z0cH?7e$f_! SCb~v"}+,ޡ'a꓄rQg>igb+nm9`*qVeLzMnŘ뛗$ǜ*W?uq$ +[r;՛wvbCМi[[^ac)Mt~mct<Ɉ_CYw3!5~U>gqSIrdacsH>EK @,ybtĶ}wwer2>ar, sG_Fm_M>?b!a5ۏγ+^PEQEW_oz}V-׻~??UZ/ҽڥZ@@3htZxBR37vQW`j01Ň$׿Z(xTntJfb7>QEU#;VWQ->Hp)m8QEx%ğf0uq+OH"u;%h>]̽ER/(54-XwʲaYrhKh-  8* |E=igOsp6QE3H[ -:;Ȟ{J /-QVm`tdlQEc,-&[s+FB7"(ȼ@}M8`&ٿn=0>QEZz\od-+ۊ(mm9\i3l%+^3i of d1 }a,ٟp.3!,Z͘0lЊ譭R1g"'cfcF\E8v;~B8HEr<@>h|i7E8,?P+J趹 JЖuP Et7jOlofFWiBúzvcOkW ray.YO$uMsXՒ=*-Rde8$xƯ8oF5cVH8IX5'#-gp떓k1n@y5%zn4;$>?A* ^>0X4(t0(G+u^:WD  K#B =/AB`T}T?<'bh5mV6POSΗyv|!<ړH:g{vEp;YY50z_S]I^Oߎ}e<φvk< kρi~9F5ABrKݲO+Nu9W}W?%wGyL>;kxL_Ox/X~~mǞ+ѴZ$Bi\SA OO⿵7~_7g}rҾaf((R_tY'ў WÞ)CO 8/On"[2_3~85z KyA܂fVqo?(C4rA 119?ANiqp UU.̧hSubr |ÞM쮑 xN? u3-`y<K'aA6RRok;H2ng'P1D2>&)@1zArHEM_,r>Our&r*yZ='|XsvUwde[BsJd6Ѷ[sXV-+|ۆXWuD Z??,Dtkd@!y?MFb$ңY1KV6n?9=ޛem*-US!T|8|1t_XW O7[o9SX-X00]Ix:>գs*Yp=3ޢ|Hޯ37ְyT 3u,3'hT'ǻ<0^+pvp3Rzc_ܶ3LkuKxnTrG?SEUwѴkX_5K1P9(?i#(n ?QNOQձprrs3EU8gIeAXǥQV(((5 iw7 8* !cQ4 Ppvg=3QVNdnsls3qzE.>Xw*3CQET_i 1H?ފ(]zJ[!aHnjysET|h-c &k98'?Z(coi-V.PO+c=pQUot V$/vImAET:jA3'/ #9sETh, &?X3p]QE-O YƒwF۷=QEfthUAdǦGj(UHL3QK.9KDi#sSװ&( LGYD5ڸ$(úDaBXD6H=?QZ6Ekov/E(h7DTWQEIEQEQEQEQEQEQEQEQEQEQEQEQEQM[ 2o2iM#igEH'$0ž|UqrktF~2?w0_zNI%9-λdz*vƨpEV}uqCb;?>5OuĖp}ƃ$ P1&68uU\_/#$hV̅wB_<;/hp#.ŋ8|8Þ ^x6FY-t~hBN9,_)7~wPBVe$NlF~F<9&Qt%Ii%%E~"i>o^\ ْU(ţ^In/l,r<;5:۪JmnN0ԚCč3zk\YՔ*M}!FWG.ZYm, WcU&=+TԼA-m`^IzjFYڏލW 56lsZ:`WnMEʤe#~(#rڙ ۥ^ңL|9ni0k,~3VHBXpp! ZZcx?7Kl.v8?J_9ԥkgF?gA?eW3{!?Ѫp=EK临^ʫzmJ¼a۰'qF9GT dqX×>F+{JP-ݺT6o<F=j,io,cMܗ$soLNd.:U0?آy3G|Pp+^rpqZrMBC"|Z[$De27SGmd.YK 泵Ik(19 VYg*SxpJLJ'>%ϭ< IOSe v֜Z:a87֩j((kMo]jſ?Zo@zwʫ]WTU]* 9 + Mo5f@%AHcފ(##IDۉ;2I_q(M,8S(DC?sEU{OH_or{*4QENGk5ô)1F$(7=EUխ4*M5FZFʙ 7(;mykc$R#}w袊F=b I5qǹBE&o{y+NYeHV_,w,:rT/ESukb-)k"Q;I =ldEB]?0|{yj(Oϳyq -<6?܍W*̗: 0U62UjV!7H}zQEb=BK.S]]y:A|{E\y>oa!kEXj~2Eu#<ȹhcC#`vC(_ĈiK+#$c#3&(Κcmk[8gR<~GƊ(q9"HSqip? =MQW55[kD\\ȣ|)3O*m`bLAgh2>?QU v -LѨ,ZBϟŠ( }%[Y湁%[-kz(]Vkp g gFӚ(ĂVf)B.. Nqފ(!^Iŭ]2I#b~R~[yϷQPM&P1ErFuAڨ=8)O\[%*U#q?QV}<$fQ,P%v2\}I {QE?u <FF]S~ EU8Gζݺ5,Kg(EzYXIB!s袊3i$֬'( E jzwAc|\`QEbFHαbs~9*ܗ>T7oH.+vN-1iX <:QEb((((((((/ddtfRG5QL3K_|:>2l|:R;0?>AL\:Hhk* aÉ!d>2?P+4mR-^+FUX6`PH }j1̈́`93Ic#jca?r?]m~ q D`Vb>kbB^{Ƕ=+oWᴾ |٥}yZm/|_.6ic(8Nd}kZFU/hOgODZ^dq^1>?&޴;/zmt%RjhQyN?CSxv붭l&| e#߭mn_YcLb75ї>c\Zg԰5uͫs6}N?qzs_O)%Yzz^ _Wz_-?"ҿi\SAi5BWSFԗv{LZ}W5^EQER?o_)C_rO W"+o#>0Ղsqw[q'5zg-?*B_ɻ uy֢n4QEGoXO$ha#:6=QO\$p} f$q>u*(6D])9hMkMI{ '?J(QCp8Rz? QE_˪AfCi}@;cx+BYO)%;pF`>QE>gN#$W:V'ĀGH#J(=oLHgo*ElXHV"#S^F8QPi :.\2 Š([W8$7lCDr~`zƊ(4饍-:VU n{r?:(Μ,yFm:Ί(McNyd/a2Dg89(gw>u,{:h((&(( 3#|rOQSE$$j%'((((((((((/lMKi7ךi=4oW¯ /|A)jԿD_VLzf۬AI #gʾ K%Ed-Oɟt+xOu);b6rHڝ9u t#'gm Ϭ\V" Ի㏚(v>si Ž[$TGs^s>қw#HTFcb WA͞fӅrI,c,OW.='÷6OZTPd[ &tl ;|ϧaz~01w}k+O=8&Rg߂OJ aI$ 6]7n%RF J6\Nӎ*:lh;̊q*2pabA) ,b>__e9m*3ẌZcp{j&.rl7ާ'$UKϱ5GqXUŤae#/zV ɂ15Z߁xoPh^j]q9՟O7wć>#Տܧ5X&'$IbcFt]L}]YձN(+7EwAtkݿg*w^R׭TQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEc"κn|QAM8Š(sxJKC\ #(($q$EQS3h 2IRnn,O<*97I#G|W$xJ(]zK[3., m$ݒN:eG#Ҋ(m|-1ٰn-X@aUAssES+e$Ǿ<]ʓdc)G5ռmaΞT#H5[X0Xa*c 0H |{f[b5PLnݹ#GwJZ['JFvHx_QВZ@J0>EeLR1URZao51J 'ZO>4+kc]nK2߿d 4㎃;~V|uDusM.٥}ff}Bt_Amr瑹cӹ4)m'6a 㱩:״]+]rg̟^{_Zx_(>?O?kT/WI}2++A?Xs_+k4o? Kqk̿hojo|UQEQE#}R;{3E] !寇)]~/Z |y eL7')_+xWfMzYB?]U{ş^s{ѿfVIPEQEW_oz}V-׻~??UZ/ҽڥZ((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((()nR=F)$b )1HFAWjt^_m3G}ێd x_4=Zu/>ַ^bоkǢSǩh$!}sTSfα[d+/$v8/|Ip$GI]|K1b ?-#=Cxu$ewN^$5WCSnluIἂHd.\dg|ݨDu!ef%OccT_A Țd9ҴіA=yztvYhvP^ʙ3I `Zfּ= ˕3yfLʤ0O֢2B&[#9\ ۝'<s֪mhd7B<%/-HN`n&68`zVe,; Ka޹}*U h$a"QrG5[#]7zf_ȩDX`95AJ`P_v[(?cPݍu{H qUn4MGPյ$Hy&cIЂ@9?p^-)?|Z5).Ke7sO=SZ0O4Znӣ-k{sݔ0$}Hp=0'/&(>a-9Lbȷ,F3끊t)g;T.}p+k4o? v{LZ}W5^EQER?o*}GqA_i4b  U-csW~+o;Ş'CS~1;VCͷ!'5z ӡjhkeT1hcԺ&6`40Hit~U6K8TzEf,62 nI|mp\6AEFOӤ(2Wlfdh 8~Q(8sYT.  Ȧ7p>B1,O`U;7"'#V~$cVMw #S .O^V0=ן?!!$JK,sYW:"0'?#vWt&6xX 5p<1Z6 u#9*/B u+7i#ױYPH߷)h py桺kʤ2S-[Sa>.@W$2ÑT~Ɐ,$b:KȮ"1pO=ϥe_YoI"+ّrGnjK}baf'yY_1R}AαW#R ZhBɫ?݅Lhv<9IM+)8$uHżG䛹I}2xCCv0| ލBĊ:Kq+OYձN袊(+7EwAtkݿg*w^R׭TQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQER,ex+-~4QE^@$(+yQ 2BIQEE%In,"A8ފ(G6\q9gq#*|3kPZ=K`ج@9;V_eR؀mV Ե(t?i%rz~UgH,|< wr?N[I .egѮ&_W}g|bGtD&4 H^W?uoHѡә\8H締g𿅬<=@<3==}]᷇ؼZ T e;ڰnonM)Tz(+N00ztQKExoa"_A>yG "__-Oi_0zjEQEQHq?(zW G![\q=p >%#$s!W N]2HY#t $hf28nafiU 9w$vrvkOPKkdo$7eerhȭ;ɆO/[f]3Y6`ez'oQ\^ z=nUVԻW\s涸rHmrh Iq$wPְ)7]$L$U>F:=B%IX#i둵@C(+łO9/Q@ÃQSxsQghqsKO峩W;pU?x+jLDgDς;(C]Z_7)UC}rFs(̓FoyHiqnrw dQE~A$H@g?:AۭQSJ'[j->݈,HENZĚt$S+Ϗ(`n} QSj.n}46(#EWoikH#FEQE>((((((((((((((((((((((((20icV&k\1Yr#Ng6!:<+dkEhtoƧӯn7ӘA;3o_9SW^̚"-=pK1 _~ byR_G\-qQuQ[ɫi>z>U9n==3L73&S~DG? @_dGx}~绸RGƉ/]Blڢ|gl=nQ]f#"MA0;aOS^VɮSO>| +V^N6>X9 tS *QEQEW*hה~/i} W4QEQEJ}y((=+cD$G6m+e8c_( F2ۉ ]#V 3b ]q5aMV^{ygY# >T.; US^{?ukIf F[#l6 AI¤SֽO AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Ry (S֏Z~?P p0G.R_OZ?iW-K?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy (S֏Z~?Q?G.R_OZ?iW-G AI5=h_C~/%g <Oy`A 6H b)/ Arc RR'MIGalRFFcTt`R' "KU@@-(¨Swx3;OZw-? |h_ KyG-? w)/?Q槭+?ߖO֏] GI~Z!?Z?wx3jz O¿'j B7 څCAi%q$O֫1ɷK&ˆ-KMlBzt~KE:s\G5e|{>}>9|VOH= +oD7>47ۥ$7BwΡ$,3s]퍚BXƤМTFqyΥ}{#{lȮ985Y$I'\|m JoͲ6#p_ze}}PRf"V'5{ρ[Aj=ao8C L)§+ GU iN޽GJpA*܌W(򬻋F@Z5;==+vM?:ϸd@aBSҵnW1 ۯzO^(g m|N]Rw^Jl5D:wUn26y`jv-n$FG5$~YGid:PK >XqX:zL]>Y{+VPÀcUYD|ݜt#THdXѕdl f cǣu--tV$N-:5~YCͲCq[IsWV@C9VL&n>bjڨ> I<`[_o +rAjZRƅe z͑3j۩Fp OnFx$C|}CZ?| O YB@ ߅vBNJs3k:QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE#R_} _j[8 |o+}056IRH>4.lDc#Jtc}"V,Cr+ոPm.1 tM&RXSL~j9LjIJ L㚤6s3irF#a'=*+e\f =j;fU~yg幒5^{g||XGun~_zZu4T|ǵSt̓-ўvzP2\*J}Q( 7lIi&WRNk=dtb 8@6 բ'Q`r տ ŖΡ1+|7 FOk?PfjnS= s:nsd<J=&<‡A 97ŸJ"RU8@R;O=գ1ZDbv9ӑF4lB^# #BQwa⥉D䞕feeϸIoHVX1V㿚31z'fW@sqD0DKoPO,/5a5IAW{;vROn=lzGHmƗgt(=UMlq|r85ۛMRÄh1h-|{8ohB`ίa"&zlO=q@ (NL 0':SDoIg󒦢KW THݧ"F}K_z8WWGyi#8,O=z}kөQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQENOZQփ?Fi (Rg+Lƾ"Coe=c\ 2zHo"48浸6㟔{ x#zsnYsxC_.4m@?_draTn|9S~"u4MGcҶ[\hڀcsd]i%%g y!楷𷉌LA7?W=V欣NЕhOMPGj `ѾWͻVψ-5Lz6#튯wa5A.Xe cx/V7{ tkk%a n[xkē[jq \